ID: 1020647229

View in Genome Browser
Species Human (GRCh38)
Location 7:10829549-10829571
Sequence TAGGTCCTTTTTCCATGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 14, 1: 15, 2: 18, 3: 7, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020647225_1020647229 7 Left 1020647225 7:10829519-10829541 CCTTCACTCTTCTAGAAGGCCAT No data
Right 1020647229 7:10829549-10829571 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111
1020647222_1020647229 20 Left 1020647222 7:10829506-10829528 CCATGCCAGGAGGCCTTCACTCT No data
Right 1020647229 7:10829549-10829571 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111
1020647223_1020647229 15 Left 1020647223 7:10829511-10829533 CCAGGAGGCCTTCACTCTTCTAG 0: 27
1: 53
2: 45
3: 55
4: 162
Right 1020647229 7:10829549-10829571 TAGGTCCTTTTTCCATGGTTTGG 0: 14
1: 15
2: 18
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020647229 Original CRISPR TAGGTCCTTTTTCCATGGTT TGG Intergenic
903344973 1:22678090-22678112 TACTCCTTTTTTCCATGGTTGGG + Intergenic
903980734 1:27186117-27186139 TAGGTCCTTTTTCCATGGTTTGG + Intergenic
907194815 1:52677991-52678013 TCTGTCCTTTTCACATGGTTTGG - Intergenic
908934541 1:69358555-69358577 TATGTCCTTTTTCCATGATTTGG - Intergenic
909576128 1:77178325-77178347 TAGGTCCTTTTTCCATGGTTTGG + Intronic
911684494 1:100759208-100759230 TAAGTAATTTTTCCAAGGTTGGG + Intergenic
916640559 1:166724432-166724454 TAGGACCTTTTTCCATGGTTTGG + Intergenic
917526829 1:175795593-175795615 CAGTCCCTTTTTACATGGTTTGG - Intergenic
919970853 1:202577002-202577024 TAGATCCTTCTTGCATTGTTTGG - Intronic
920157271 1:203964292-203964314 TAGGCCCTTTTTCCATGGTTTGG - Intergenic
1064914715 10:20443668-20443690 GCGGTCCTGTTTCCATAGTTTGG - Intergenic
1065816332 10:29486473-29486495 TAATTCCTTCTTCAATGGTTTGG + Exonic
1066011629 10:31199821-31199843 TTTGTCCCTCTTCCATGGTTTGG - Intergenic
1067422061 10:46160527-46160549 TAGGTCCTTTTTCCATAGTTTGG + Intergenic
1067507368 10:46866616-46866638 TAGGTCCTTTTTCCATAGTTTGG + Intergenic
1067957456 10:50807997-50808019 TTGGTCCATTTTCCAAGGATAGG + Intronic
1068348252 10:55812420-55812442 TAGGTCCTTTTTTTGTGGTTTGG - Intergenic
1070045981 10:72837324-72837346 TATGTGTTTGTTCCATGGTTTGG - Intronic
1070859553 10:79639665-79639687 TAGGTCCTTATTCCATAGTTTGG + Intergenic
1076003919 10:126932954-126932976 TCAGTCCTTTTTCCATAGGTTGG + Intronic
1079953393 11:26832627-26832649 TAGGTCTTTTGACCAGGGTTGGG + Intergenic
1080810002 11:35694269-35694291 TAGGTCCTTTGTCCATGATTTGG - Intronic
1083602219 11:63955821-63955843 TAGGTGCTTTTTCCTTGATAAGG - Exonic
1085773661 11:79346915-79346937 TAGGTCCTGATCTCATGGTTCGG + Intronic
1087962177 11:104365989-104366011 TAGGGCCCTTTTCCATAGTGTGG - Intergenic
1088716267 11:112552618-112552640 TAGGTCAGTTATCCCTGGTTTGG + Intergenic
1089028609 11:115298426-115298448 TAGATCCTATTTTCATGGCTTGG + Intronic
1091128703 11:133125138-133125160 TAGCTCCTTTCTCAATGCTTTGG + Intronic
1094183203 12:27613877-27613899 TAGCTCCCATTTCCATCGTTTGG + Intronic
1094239588 12:28206856-28206878 TAGGTCCTTTTTCCACGGTTTGG - Intronic
1095890763 12:47233658-47233680 TTGCTCCTCTTTCCCTGGTTGGG + Intronic
1098004859 12:65985550-65985572 TAGGTTCTTTTTTCATGGCTTGG - Intergenic
1098294419 12:68990018-68990040 TAGGTCCCTTTTCCATGATTTGG + Intergenic
1099799050 12:87434001-87434023 TAGGTCTTTATGTCATGGTTTGG + Intergenic
1099854970 12:88152371-88152393 TGGGTCCTTTATGAATGGTTTGG - Intronic
1103024564 12:117563122-117563144 TAGCTCTTTCTTCCATGGGTAGG - Intronic
1107521962 13:41192512-41192534 TCGGTTCTTTTTCCATTGTGGGG + Exonic
1108954359 13:56134120-56134142 TAGATCCTTTCTACATGCTTTGG - Intergenic
1110960108 13:81610648-81610670 TAGGTCCTTTTTCCATGGTTTGG + Intergenic
1115810577 14:37102588-37102610 TTGATCCTTTTTCTATGTTTTGG - Intronic
1116234947 14:42268058-42268080 TAGGTCCTTTTTCCATAGTTTGG - Intergenic
1119293363 14:73513821-73513843 TGGGTGCTTTTTGCATGGATGGG - Intronic
1125036466 15:35130317-35130339 TTGTTCAGTTTTCCATGGTTCGG - Intergenic
1125181286 15:36882981-36883003 TTGGTTCTTTTTCAACGGTTCGG - Intergenic
1127654349 15:61042270-61042292 TAGCACCTTCTTTCATGGTTTGG - Intronic
1128602048 15:69003743-69003765 AAGTCTCTTTTTCCATGGTTTGG - Intronic
1137317859 16:47346824-47346846 TAGTTCTTCTTTACATGGTTTGG - Intronic
1142367204 16:89656949-89656971 TAGGTCCCGGGTCCATGGTTGGG + Intronic
1144426682 17:15149519-15149541 TAGGTCCTATTTCCATGGCTTGG + Intergenic
1146624648 17:34425978-34426000 TAGGTGCCCTTTCCAAGGTTAGG - Intergenic
1153118168 18:1686486-1686508 TAGTTCCTTTTTTCATCGTTTGG - Intergenic
1153439038 18:5097013-5097035 TAGGCCCTTTTGTCATGGTCAGG - Intergenic
1154365685 18:13706611-13706633 TAGGTCCTTTTTTCACGGTTTGG + Intronic
1155916376 18:31561544-31561566 TTGGTTCTCTTTCCATGGGTCGG - Intergenic
1156580821 18:38372877-38372899 TAAGTCATTTTACCATGATTAGG - Intergenic
1162810778 19:13163306-13163328 TCGGCCCTTTTTCCCTGATTGGG - Intergenic
1162871243 19:13588403-13588425 TAGGTTCTTTTTTAAAGGTTAGG + Intronic
1164220662 19:23190652-23190674 TCAGTCCTTTTCCCATTGTTTGG - Intergenic
927335723 2:21921868-21921890 TTGGTACTATTTCCATTGTTTGG - Intergenic
927658754 2:24973909-24973931 TAGCTGCTTTTTCCATAGTATGG + Intergenic
928382641 2:30832958-30832980 TAGGTCCTTTTTCCATGGTTTGG + Intergenic
935694018 2:105755204-105755226 TAGGTCTATTTTACATGGTTCGG + Intronic
935698284 2:105788387-105788409 TCAGTCTTTTTTCCATGCTTAGG + Intronic
937755085 2:125527319-125527341 TAGGTCATTTTTCTTAGGTTGGG + Intergenic
941010486 2:160294058-160294080 TGGGTTCTTTTACCCTGGTTGGG + Intronic
943112010 2:183618512-183618534 GGAGTCCTTTTTCCATTGTTTGG + Intergenic
944151362 2:196561986-196562008 TATTTCCTTTTGACATGGTTAGG + Intronic
944734884 2:202553514-202553536 TATTTCTTTTTTCCATGTTTGGG + Intronic
945215871 2:207433579-207433601 AAGGTCCTTGATCCATGGATGGG - Intergenic
945613993 2:212044786-212044808 TGGTTCCTTTTTCTATGATTAGG - Intronic
945944806 2:215984605-215984627 TAGTGCCTCTTTCTATGGTTTGG - Intronic
947437000 2:230081348-230081370 TATGTGCTTTTTCCTTGGCTTGG + Intergenic
1169669997 20:8088215-8088237 TTTTTCCTTTTTCCATTGTTTGG + Intergenic
1169984879 20:11433189-11433211 TAGCTTCCTTTTCCATGGATAGG + Intergenic
1171318501 20:24217890-24217912 TAGGTCCTTTTTCCATGGTTTGG - Intergenic
1173951733 20:46998688-46998710 TGCTTCCTTTCTCCATGGTTAGG - Intronic
1175114328 20:56671463-56671485 TAGCTCCTATTTCCATCCTTGGG - Intergenic
1176668367 21:9708631-9708653 CAGGTCCCTTTTCCTTTGTTTGG + Intergenic
1179433536 21:41343594-41343616 TTCCTCCTTTTTCCATGCTTTGG - Intronic
1180019862 21:45116042-45116064 TAAGTCCTTTGTGCAAGGTTGGG + Intronic
1182088829 22:27580297-27580319 TGGCTCCGTTTTCCATTGTTGGG - Intergenic
1182840568 22:33386123-33386145 TAGGTCCTTTGTGCTTTGTTAGG + Intronic
1182887058 22:33783273-33783295 TAGTCCCTTTTCCCATGATTTGG - Intronic
1184618702 22:45656655-45656677 TAGGTCCTTTTTGCATGGTTTGG + Intergenic
951170079 3:19531608-19531630 AAGGAGGTTTTTCCATGGTTTGG - Intronic
951574164 3:24096670-24096692 TAGGTCCTTTTTGGATTTTTAGG + Intergenic
954195530 3:48994570-48994592 TAGGTCATTTTCCCTTGGTAGGG + Intronic
957750866 3:84413563-84413585 TAGGTCCTTTTTCCATGGATTGG + Intergenic
959547704 3:107615958-107615980 TAGGTTCTCATTCCATGGGTGGG - Intronic
960235059 3:115272656-115272678 AAGGTCCTTTTGGAATGGTTGGG + Intergenic
961596267 3:128020231-128020253 TATGTCCTTTTTCCATGGTTTGG + Intergenic
962246080 3:133794942-133794964 TAGGTCCTTTTTCCATGATTTGG + Intronic
963605031 3:147406182-147406204 TGGGGCCTTTATCCACGGTTGGG + Intronic
965096067 3:164227702-164227724 AGATTCCTTTTTCCATGGTTTGG - Intergenic
971719653 4:30229277-30229299 TAGGTCCTTTTTCCATGGTTTGG - Intergenic
978950727 4:114555888-114555910 TAGGTCCTTTTTCCATAGTTTGG - Intergenic
979170122 4:117591183-117591205 TAGTTACTTTTTCCTTGGGTTGG - Intergenic
980604001 4:135065573-135065595 TAGGTCTTATTTCTATGCTTGGG - Intergenic
981536408 4:145804756-145804778 TAGGTACTATTTCCATGAGTGGG + Intronic
982318367 4:154054996-154055018 TAGTCTCTTTTTCCATTGTTAGG + Intergenic
983426501 4:167590307-167590329 TTGGTCTTTTTTACAAGGTTGGG - Intergenic
983835488 4:172378300-172378322 AAGGTCCTTTTTCCTTGAATCGG - Intronic
983859179 4:172683507-172683529 CAAGTCCTTTTTCAAGGGTTAGG - Intronic
985406415 4:189642880-189642902 CAGGTCCCTTTTCCTTTGTTTGG - Intergenic
988004379 5:25388990-25389012 AAGGTAATTTTTCCATGGATGGG + Intergenic
988567972 5:32335462-32335484 TAGGTTCTTTTCCCACGGTTTGG - Intergenic
989122910 5:38021945-38021967 TACCTTCTTTTTCCAAGGTTGGG - Intergenic
990082005 5:51928510-51928532 TAGGTCCTTTTTCCATGGTTTGG + Intergenic
990192742 5:53278694-53278716 TAATTCCTTTTACCAAGGTTTGG + Intergenic
993248793 5:85487674-85487696 TGGGTTCTTTTTCCATGGTTTGG + Intergenic
994467661 5:100159013-100159035 AAGATCCTTTTTTCATTGTTTGG - Intergenic
994978686 5:106844121-106844143 CAGTTCCTTTTCCCATGTTTTGG - Intergenic
996094449 5:119383399-119383421 TAGGTCTTTATTTAATGGTTGGG - Intronic
998986102 5:147759072-147759094 TTGATCCTATTTCCATGGCTGGG + Intronic
1002378907 5:178810732-178810754 TTGGCCCATTTGCCATGGTTTGG - Intergenic
1003613455 6:7633839-7633861 TCGATTCTTTTTCCATTGTTAGG + Intergenic
1004765935 6:18726804-18726826 TAGGTCCTTTTTCTATGGTATGG + Intergenic
1005095539 6:22110816-22110838 CAGGTCCTCTCTCCATGCTTAGG + Intergenic
1005850535 6:29817453-29817475 TAGGCCCATATTCCATGGGTGGG + Intergenic
1008290979 6:49715800-49715822 TAGTTCCTTTTTCTATGGTTTGG + Intergenic
1013771122 6:113629277-113629299 TATGTCCTTTTTGCTTTGTTTGG - Intergenic
1014162941 6:118191058-118191080 TAGGTCCTTTTTCCATGGTTTGG - Intronic
1015831324 6:137372208-137372230 AGGTTGCTTTTTCCATGGTTTGG - Intergenic
1019270797 7:147247-147269 TAGGTCCTTTTTCCATGGTTTGG - Intergenic
1020647229 7:10829549-10829571 TAGGTCCTTTTTCCATGGTTTGG + Intergenic
1021313346 7:19117819-19117841 CAGGTCGTTTTTGAATGGTTTGG - Intergenic
1022708623 7:32830872-32830894 AAGGTAATTTTTCCATGGATTGG - Intergenic
1023923169 7:44645639-44645661 TAGGTGCTTTCTCCCTGCTTTGG + Intronic
1023975783 7:45028753-45028775 AAGGTCCTTTTTCCATTGGTAGG + Intronic
1030983739 7:116215638-116215660 TAGGGCCATTTTACATAGTTAGG - Intronic
1033072366 7:138215835-138215857 TAGGTCCTTTTTCCATGGTTTGG - Intergenic
1033962887 7:146935531-146935553 TAGGTACTTTTTCCATGGTTTGG + Intronic
1038623816 8:29171015-29171037 CCAGTCCTTTCTCCATGGTTAGG - Intronic
1039811050 8:41048670-41048692 TAAATCCTTCTTCCATGATTTGG - Intergenic
1046202581 8:110946828-110946850 TAGGTCCTTTTTCCATGGTTTGG - Intergenic
1046579368 8:116072631-116072653 TAGGTCCTTTTTCCAAAGTTTGG + Intergenic
1051802662 9:20953804-20953826 TAGGTCAGTCTTCCTTGGTTAGG + Intronic
1056430310 9:86520926-86520948 TAGGTCTTTTTTCCACGGTTTGG + Intergenic
1057781148 9:98051572-98051594 TAAGTCCTTTTTCTATGGTTTGG - Intergenic
1058098611 9:100892188-100892210 TAGGTTCTTTTGCCATGGTTTGG + Intergenic
1058421388 9:104836329-104836351 TATTTCCTGTTTCCATGGTGAGG - Intronic
1058909739 9:109509862-109509884 AAGGGCAGTTTTCCATGGTTTGG + Intergenic
1060019813 9:120119491-120119513 CAGGCCCTTTTTCCATACTTTGG - Intergenic
1060707259 9:125815384-125815406 TATATCATTTTTCCATGGTAAGG + Intronic
1061729422 9:132602111-132602133 TTGGTCTTATTTCCATTGTTTGG - Intronic
1203657500 Un_KI270753v1:12324-12346 CAGGTCCCTTTTCCTTTGTTTGG - Intergenic
1186118054 X:6325969-6325991 TTGGGCATTTTTACATGGTTTGG - Intergenic
1186893398 X:13982402-13982424 TAGGTCCTTTTTCCATGGTTTGG + Intergenic
1188637056 X:32446839-32446861 TTAGTCCTTTTTCACTGGTTTGG - Intronic
1188803080 X:34555569-34555591 GTGGTCCTTTTTCCATGGTTTGG + Intergenic
1189029800 X:37438926-37438948 TAGTTCCTTCTTCCAATGTTAGG + Intronic
1191210039 X:57875328-57875350 TAAGACCTTTTCCCATGGTCTGG - Intergenic
1191789651 X:64955988-64956010 TAGATCTTTCTTCCTTGGTTTGG + Intronic
1193477011 X:81978743-81978765 TAGGTCATTTTTCTATGATTTGG + Intergenic
1194051510 X:89074928-89074950 TAGGTCATTTTTCCATGGTTTGG - Intergenic
1194087009 X:89540264-89540286 TAATTCTTTTTTCCATGGTAAGG - Intergenic
1194187972 X:90797376-90797398 TAGGTCCTTTTTCTATGATTTGG + Intergenic
1195558717 X:106258103-106258125 TAGGTCCTTTTTCCATGGTTTGG - Intergenic
1196400788 X:115313896-115313918 TAGGTACTTTTTCCATGGTTTGG - Intergenic
1196464111 X:115956048-115956070 TAGGTCCTTTTTCCATTGTTTGG + Intergenic
1197554136 X:127933778-127933800 TTGGTCCTTTTTTCATGGTTTGG + Intergenic
1197934466 X:131726632-131726654 TAAGTCCTTTTTCCATGATTTGG + Intergenic
1200089959 X:153630422-153630444 TTTGTCCCTTTTCCATGGTGAGG + Intergenic
1200439659 Y:3196134-3196156 TAATTCTTTTTTCCATGGTAAGG - Intergenic
1200534562 Y:4379323-4379345 TAGGTCCTTTTTCTATGATTTGG + Intergenic