ID: 1020649209

View in Genome Browser
Species Human (GRCh38)
Location 7:10854863-10854885
Sequence ACAGCTGGGTGCTGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020649198_1020649209 29 Left 1020649198 7:10854811-10854833 CCAGACTTTGGACATCAAAGAGC No data
Right 1020649209 7:10854863-10854885 ACAGCTGGGTGCTGGCCTGCAGG No data
1020649205_1020649209 -6 Left 1020649205 7:10854846-10854868 CCGAGAGGTGGCTGAAGACAGCT No data
Right 1020649209 7:10854863-10854885 ACAGCTGGGTGCTGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020649209 Original CRISPR ACAGCTGGGTGCTGGCCTGC AGG Intergenic
No off target data available for this crispr