ID: 1020650458

View in Genome Browser
Species Human (GRCh38)
Location 7:10868797-10868819
Sequence ATGCCCATCTGTAAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020650458_1020650460 -6 Left 1020650458 7:10868797-10868819 CCCTCACTTTTACAGATGGGCAT No data
Right 1020650460 7:10868814-10868836 GGGCATCATCCAATCTACTGAGG No data
1020650458_1020650463 14 Left 1020650458 7:10868797-10868819 CCCTCACTTTTACAGATGGGCAT No data
Right 1020650463 7:10868834-10868856 AGGGCCTGAATAGAACTAAAAGG No data
1020650458_1020650461 -5 Left 1020650458 7:10868797-10868819 CCCTCACTTTTACAGATGGGCAT No data
Right 1020650461 7:10868815-10868837 GGCATCATCCAATCTACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020650458 Original CRISPR ATGCCCATCTGTAAAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr