ID: 1020650929

View in Genome Browser
Species Human (GRCh38)
Location 7:10875262-10875284
Sequence CTGGACAGACACTGGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020650929_1020650936 25 Left 1020650929 7:10875262-10875284 CCTAGCTGCCAGTGTCTGTCCAG No data
Right 1020650936 7:10875310-10875332 GATAGAGCCAGGCCAGCTCCTGG No data
1020650929_1020650935 14 Left 1020650929 7:10875262-10875284 CCTAGCTGCCAGTGTCTGTCCAG No data
Right 1020650935 7:10875299-10875321 ATGATCTAGATGATAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020650929 Original CRISPR CTGGACAGACACTGGCAGCT AGG (reversed) Intergenic
No off target data available for this crispr