ID: 1020650936

View in Genome Browser
Species Human (GRCh38)
Location 7:10875310-10875332
Sequence GATAGAGCCAGGCCAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020650934_1020650936 -10 Left 1020650934 7:10875297-10875319 CCATGATCTAGATGATAGAGCCA No data
Right 1020650936 7:10875310-10875332 GATAGAGCCAGGCCAGCTCCTGG No data
1020650933_1020650936 -1 Left 1020650933 7:10875288-10875310 CCAGGAACGCCATGATCTAGATG No data
Right 1020650936 7:10875310-10875332 GATAGAGCCAGGCCAGCTCCTGG No data
1020650932_1020650936 6 Left 1020650932 7:10875281-10875303 CCAGTTTCCAGGAACGCCATGAT No data
Right 1020650936 7:10875310-10875332 GATAGAGCCAGGCCAGCTCCTGG No data
1020650929_1020650936 25 Left 1020650929 7:10875262-10875284 CCTAGCTGCCAGTGTCTGTCCAG No data
Right 1020650936 7:10875310-10875332 GATAGAGCCAGGCCAGCTCCTGG No data
1020650930_1020650936 17 Left 1020650930 7:10875270-10875292 CCAGTGTCTGTCCAGTTTCCAGG No data
Right 1020650936 7:10875310-10875332 GATAGAGCCAGGCCAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020650936 Original CRISPR GATAGAGCCAGGCCAGCTCC TGG Intergenic
No off target data available for this crispr