ID: 1020650938

View in Genome Browser
Species Human (GRCh38)
Location 7:10875318-10875340
Sequence CAGGCCAGCTCCTGGCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020650932_1020650938 14 Left 1020650932 7:10875281-10875303 CCAGTTTCCAGGAACGCCATGAT No data
Right 1020650938 7:10875318-10875340 CAGGCCAGCTCCTGGCTGTCAGG No data
1020650930_1020650938 25 Left 1020650930 7:10875270-10875292 CCAGTGTCTGTCCAGTTTCCAGG No data
Right 1020650938 7:10875318-10875340 CAGGCCAGCTCCTGGCTGTCAGG No data
1020650934_1020650938 -2 Left 1020650934 7:10875297-10875319 CCATGATCTAGATGATAGAGCCA No data
Right 1020650938 7:10875318-10875340 CAGGCCAGCTCCTGGCTGTCAGG No data
1020650933_1020650938 7 Left 1020650933 7:10875288-10875310 CCAGGAACGCCATGATCTAGATG No data
Right 1020650938 7:10875318-10875340 CAGGCCAGCTCCTGGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020650938 Original CRISPR CAGGCCAGCTCCTGGCTGTC AGG Intergenic
No off target data available for this crispr