ID: 1020652133

View in Genome Browser
Species Human (GRCh38)
Location 7:10888765-10888787
Sequence CAAATTAGGTAGTTGAAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020652133_1020652137 9 Left 1020652133 7:10888765-10888787 CCAGTCTTCAACTACCTAATTTG No data
Right 1020652137 7:10888797-10888819 AACCAGAATCCCAAGTAAGTGGG No data
1020652133_1020652136 8 Left 1020652133 7:10888765-10888787 CCAGTCTTCAACTACCTAATTTG No data
Right 1020652136 7:10888796-10888818 AAACCAGAATCCCAAGTAAGTGG No data
1020652133_1020652141 25 Left 1020652133 7:10888765-10888787 CCAGTCTTCAACTACCTAATTTG No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020652133 Original CRISPR CAAATTAGGTAGTTGAAGAC TGG (reversed) Intergenic
No off target data available for this crispr