ID: 1020652135 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:10888789-10888811 |
| Sequence | CTTGGGATTCTGGTTTCTCA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1020652135_1020652142 | 17 | Left | 1020652135 | 7:10888789-10888811 | CCGTGAGAAACCAGAATCCCAAG | No data | ||
| Right | 1020652142 | 7:10888829-10888851 | CTGAAGGTCATATAAGTAATTGG | No data | ||||
| 1020652135_1020652141 | 1 | Left | 1020652135 | 7:10888789-10888811 | CCGTGAGAAACCAGAATCCCAAG | No data | ||
| Right | 1020652141 | 7:10888813-10888835 | AAGTGGGAGTGACTTGCTGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1020652135 | Original CRISPR | CTTGGGATTCTGGTTTCTCA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||