ID: 1020652135

View in Genome Browser
Species Human (GRCh38)
Location 7:10888789-10888811
Sequence CTTGGGATTCTGGTTTCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020652135_1020652142 17 Left 1020652135 7:10888789-10888811 CCGTGAGAAACCAGAATCCCAAG No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data
1020652135_1020652141 1 Left 1020652135 7:10888789-10888811 CCGTGAGAAACCAGAATCCCAAG No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020652135 Original CRISPR CTTGGGATTCTGGTTTCTCA CGG (reversed) Intergenic
No off target data available for this crispr