ID: 1020652136

View in Genome Browser
Species Human (GRCh38)
Location 7:10888796-10888818
Sequence AAACCAGAATCCCAAGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020652133_1020652136 8 Left 1020652133 7:10888765-10888787 CCAGTCTTCAACTACCTAATTTG No data
Right 1020652136 7:10888796-10888818 AAACCAGAATCCCAAGTAAGTGG No data
1020652134_1020652136 -6 Left 1020652134 7:10888779-10888801 CCTAATTTGTCCGTGAGAAACCA No data
Right 1020652136 7:10888796-10888818 AAACCAGAATCCCAAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020652136 Original CRISPR AAACCAGAATCCCAAGTAAG TGG Intergenic
No off target data available for this crispr