ID: 1020652138

View in Genome Browser
Species Human (GRCh38)
Location 7:10888799-10888821
Sequence CTCCCACTTACTTGGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020652138_1020652141 -9 Left 1020652138 7:10888799-10888821 CCAGAATCCCAAGTAAGTGGGAG No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data
1020652138_1020652142 7 Left 1020652138 7:10888799-10888821 CCAGAATCCCAAGTAAGTGGGAG No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020652138 Original CRISPR CTCCCACTTACTTGGGATTC TGG (reversed) Intergenic
No off target data available for this crispr