ID: 1020652141

View in Genome Browser
Species Human (GRCh38)
Location 7:10888813-10888835
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020652133_1020652141 25 Left 1020652133 7:10888765-10888787 CCAGTCTTCAACTACCTAATTTG No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data
1020652138_1020652141 -9 Left 1020652138 7:10888799-10888821 CCAGAATCCCAAGTAAGTGGGAG No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data
1020652134_1020652141 11 Left 1020652134 7:10888779-10888801 CCTAATTTGTCCGTGAGAAACCA No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data
1020652135_1020652141 1 Left 1020652135 7:10888789-10888811 CCGTGAGAAACCAGAATCCCAAG No data
Right 1020652141 7:10888813-10888835 AAGTGGGAGTGACTTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020652141 Original CRISPR AAGTGGGAGTGACTTGCTGA AGG Intergenic