ID: 1020652142

View in Genome Browser
Species Human (GRCh38)
Location 7:10888829-10888851
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020652139_1020652142 0 Left 1020652139 7:10888806-10888828 CCCAAGTAAGTGGGAGTGACTTG No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data
1020652134_1020652142 27 Left 1020652134 7:10888779-10888801 CCTAATTTGTCCGTGAGAAACCA No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data
1020652135_1020652142 17 Left 1020652135 7:10888789-10888811 CCGTGAGAAACCAGAATCCCAAG No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data
1020652140_1020652142 -1 Left 1020652140 7:10888807-10888829 CCAAGTAAGTGGGAGTGACTTGC No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data
1020652138_1020652142 7 Left 1020652138 7:10888799-10888821 CCAGAATCCCAAGTAAGTGGGAG No data
Right 1020652142 7:10888829-10888851 CTGAAGGTCATATAAGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020652142 Original CRISPR CTGAAGGTCATATAAGTAAT TGG Intergenic