ID: 1020656539

View in Genome Browser
Species Human (GRCh38)
Location 7:10935183-10935205
Sequence CTGCTTAGTTTTAAGAAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020656539 Original CRISPR CTGCTTAGTTTTAAGAAAAT TGG (reversed) Intronic
902062216 1:13654806-13654828 CTGCTTCATTTTAAAAATATTGG - Intergenic
904239997 1:29137847-29137869 CAGTTTAGTTTTAAGAAACAGGG + Intergenic
905625005 1:39483848-39483870 CTACTTAGTGTTAAGAGATTGGG + Intronic
906392497 1:45430984-45431006 CTGCTTACTTTTCAGTAGATGGG - Intronic
908375015 1:63527878-63527900 CTGTTCAGTTTTGAGAAAAAAGG - Intronic
911977409 1:104516672-104516694 CTGTTTAATTTTAAAAAAACAGG + Intergenic
912901457 1:113654316-113654338 ATGCTGACTTTTAAGAAAATGGG + Intronic
916979636 1:170119620-170119642 CTGGTTAGTTTTCAGAGAAAAGG + Intergenic
917719964 1:177777963-177777985 CTGCTTTCTTTATAGAAAATAGG - Intergenic
918912717 1:190594604-190594626 ATGACTAGTATTAAGAAAATAGG + Intergenic
919037252 1:192329482-192329504 CTGCTTATTATTAAGAGAAAAGG + Intronic
919233705 1:194809263-194809285 GAGGTTAGTTTTAAAAAAATAGG + Intergenic
919574652 1:199292882-199292904 CTGCTTTATTTAAAGCAAATGGG - Intergenic
920505151 1:206510370-206510392 CTTCTTTGTTTAAAAAAAATAGG + Intronic
921425293 1:214994344-214994366 CCGCTTAGTTGCAGGAAAATAGG + Intergenic
922581139 1:226698883-226698905 CCTCTTAATTTTAAGCAAATAGG - Intronic
923637815 1:235718655-235718677 ATGTTTAGTTTAAAGAAAAATGG - Intronic
923953699 1:238990524-238990546 ATAATTATTTTTAAGAAAATAGG + Intergenic
924402699 1:243704215-243704237 TTACTTAGATTTAAGAAAAACGG + Intronic
924629070 1:245720392-245720414 CTTCTCAGTTTCAAGAAACTAGG + Intergenic
1063005479 10:1966272-1966294 CTGAATAGTTTGAAGAAAATTGG + Intergenic
1063858290 10:10279877-10279899 CTGCATAGTTCTAAGCAGATAGG + Intergenic
1064064259 10:12167443-12167465 CTGTTGAGCTTTAAAAAAATTGG + Exonic
1066972829 10:42330405-42330427 CTTCTTAATTTTAAGAAATCTGG - Intergenic
1067118774 10:43456261-43456283 CTGCTCTGTTTTTAGAAACTCGG - Intronic
1067154962 10:43773237-43773259 CTGTTTAGTTTTAAGGAGTTTGG + Intergenic
1067319823 10:45206921-45206943 TTGTTTAGTTTTAATAAGATTGG + Intergenic
1067807064 10:49399897-49399919 TTGCCTTGTTTTAGGAAAATTGG + Intergenic
1069925296 10:71846126-71846148 CTGTTTAGCTTTAATAAATTAGG - Intronic
1070945825 10:80390819-80390841 CAGCTTTCTTTTAAGAAAAACGG - Intergenic
1072500988 10:96017587-96017609 CAGCGTAGTTTTAATAATATGGG + Intronic
1072858722 10:98979402-98979424 ATGCTTATTTTTTAAAAAATAGG - Intronic
1074171517 10:110943765-110943787 TTGTTTAGATATAAGAAAATAGG - Intronic
1074267146 10:111915844-111915866 CTGCTAAGTTTTACCAATATGGG + Intergenic
1074700710 10:116089652-116089674 CTGCATACATTTCAGAAAATGGG + Intronic
1075755936 10:124811424-124811446 CTGTTTATTTTTAAAGAAATAGG + Intronic
1075821523 10:125317005-125317027 CATCTTATTTTCAAGAAAATTGG + Intergenic
1075856514 10:125634692-125634714 CTTCTGATTTTTAACAAAATGGG - Intronic
1076820128 10:132934183-132934205 GTGTATATTTTTAAGAAAATGGG - Intronic
1078670816 11:13363707-13363729 CTGCCTAGTTTTCAAAACATGGG - Intronic
1079193418 11:18302065-18302087 CTGCTTGGGGTTAAGAAAATGGG - Intronic
1079391398 11:20024849-20024871 CTACTTAGTTTTAAGACAGCTGG + Intronic
1079863310 11:25701999-25702021 CTGTTTGTTTTTAAGAGAATGGG + Intergenic
1080459733 11:32443475-32443497 CTGCTTATTTTGAAGAACATGGG - Intergenic
1081263544 11:40990436-40990458 CTGCTTAGTTTTGTGAACTTGGG - Intronic
1083024441 11:59538140-59538162 ATGCTTTGTTTTAATGAAATAGG + Intergenic
1083983071 11:66190557-66190579 CTTTTTATTTTTAAGAGAATGGG + Intronic
1084849519 11:71927831-71927853 ATGATTATTTTTAAGTAAATGGG + Intronic
1085460104 11:76688418-76688440 CTGCTTAGTCTTAGGGCAATGGG + Intergenic
1086410285 11:86538196-86538218 ATGCTGAGTTTTAACAATATAGG + Intronic
1086972035 11:93092067-93092089 ATGCTTAAATTTAAAAAAATAGG - Intergenic
1087411901 11:97801625-97801647 CTGTTTAGTTTTAAAGAATTAGG + Intergenic
1088177267 11:107067854-107067876 CTCCTTAGTGTTAAGAAGTTAGG + Intergenic
1088315295 11:108499973-108499995 CTGCTTAGCATTACTAAAATAGG - Intergenic
1090475590 11:127017305-127017327 CTGCTTAGATTTTTAAAAATTGG - Intergenic
1093867972 12:24251421-24251443 CTTCTTACATTTAATAAAATAGG + Intergenic
1095043428 12:37470618-37470640 GTGTTTATTTTTAACAAAATTGG - Intergenic
1095251741 12:39987067-39987089 CCTTTTAGTTTTAAGAAAAATGG + Intronic
1095361801 12:41351238-41351260 TTGCTTAGTTTTAAGAAAATGGG - Intronic
1095425895 12:42074494-42074516 CTGCTTGGTTTGAAGAGAAAGGG + Intergenic
1095562169 12:43578525-43578547 CTTCATAGTTTTAAAATAATTGG + Intergenic
1097200833 12:57277220-57277242 CTACTTCATTTTAAGTAAATTGG + Intronic
1097355836 12:58600632-58600654 TTGTTTAGATTTATGAAAATTGG - Intronic
1097602447 12:61710460-61710482 GTGTTTAGTTTTAAGATTATCGG - Intronic
1098103594 12:67045333-67045355 TTGCTGAGTTTTAAGAAAGCAGG + Intergenic
1099571518 12:84325944-84325966 CTGCTTAGTCTTATGGAAAATGG - Intergenic
1100080276 12:90840950-90840972 CTGCATATTTTTAAAAAATTGGG - Intergenic
1100654557 12:96627531-96627553 CTGTTTACTTTTATTAAAATGGG - Intronic
1100688677 12:97014739-97014761 CAACTTAGTTGTAAGCAAATGGG + Intergenic
1101275860 12:103200165-103200187 CTGCTTATTTGAAACAAAATGGG + Intergenic
1101288935 12:103346904-103346926 CTGTTTAGTCTTAAGGAAAGTGG + Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102596785 12:113999041-113999063 CTGGTCATTTTGAAGAAAATGGG + Intergenic
1105042091 12:132968524-132968546 CTGGGTAATTATAAGAAAATAGG + Intergenic
1106837216 13:33647571-33647593 ATTGTTAGTATTAAGAAAATAGG - Intergenic
1106848490 13:33763217-33763239 GTGAATAATTTTAAGAAAATTGG - Intergenic
1107594063 13:41943398-41943420 CTGCTTTGTTTTAAAAGGATAGG - Intronic
1107810174 13:44193106-44193128 CTGTTTAAATTTTAGAAAATAGG + Intergenic
1108196372 13:47999997-48000019 CTATTTAGTTTTTAGAAAATGGG - Intronic
1109814222 13:67558682-67558704 CTACTTACTTTTAAATAAATTGG - Intergenic
1110306146 13:73988765-73988787 CAGTTTAGCTTTAGGAAAATTGG - Intronic
1111239219 13:85452830-85452852 TTATTTAGTTTTAAGAAAAGTGG + Intergenic
1113022817 13:105907356-105907378 CTGCTTAATTTTATGATGATAGG + Intergenic
1115437503 14:33392028-33392050 ATTTTTAGTTTAAAGAAAATGGG + Intronic
1116466383 14:45238151-45238173 CTTTTTAGTTTGTAGAAAATTGG - Intronic
1116477255 14:45355112-45355134 CTGCTGACTTTTAAAAAGATTGG + Intergenic
1116622046 14:47217499-47217521 CTGATTACTTTTAACAGAATTGG + Intronic
1117350499 14:54877041-54877063 CTGGTTCATTTTAATAAAATGGG - Intronic
1117989875 14:61422790-61422812 CTGCTTCTTTTAAAAAAAATGGG - Intronic
1120086149 14:80275894-80275916 CTGCATAATTATTAGAAAATAGG + Intronic
1120647485 14:87090918-87090940 CTGATTAATTTTTAGGAAATAGG + Intergenic
1202941974 14_KI270725v1_random:158231-158253 GTGTTTATTTTTAACAAAATTGG - Intergenic
1123725219 15:23094649-23094671 ATGCATATTTTTAACAAAATTGG + Intergenic
1126318911 15:47400561-47400583 CAGCTTCCTCTTAAGAAAATGGG - Intronic
1131588615 15:93722856-93722878 CTGCTCAGTTTAAAGAAAAAAGG - Intergenic
1131844077 15:96470406-96470428 ATACTTATTTTAAAGAAAATAGG + Intergenic
1132410282 15:101572625-101572647 TTGCATAGTTTTGAGATAATTGG + Intergenic
1134233631 16:12448835-12448857 ATGCTTAGTTAGAAGAAAATGGG - Intronic
1135536199 16:23296314-23296336 CTGCTTATTTTCCAGAAAATCGG + Intronic
1137785215 16:51132908-51132930 CTGCTAAGTTTTAACAGAGTAGG + Intergenic
1137961639 16:52887279-52887301 TTTCTTGGTTTTAAGAAACTGGG - Intergenic
1140452979 16:75086673-75086695 GTGCTTAGTGTCAATAAAATGGG - Intronic
1140539329 16:75741272-75741294 AAACTTAGTTTTAAGAATATTGG + Intronic
1141062756 16:80889538-80889560 GTGCTTAGTTTTAAGAATCTGGG - Intergenic
1142166063 16:88589048-88589070 CTGCTTTGTTATGAGAAATTTGG + Intronic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1144279886 17:13715600-13715622 CTGCCTAGTTTGAGGAAAAGAGG - Intergenic
1146604617 17:34247597-34247619 CTGCTAAGTTTCAAGCAAAGTGG + Intergenic
1146835051 17:36104156-36104178 TTGCTAATTCTTAAGAAAATAGG - Intronic
1146849663 17:36211392-36211414 TTGCTAATTCTTAAGAAAATAGG - Intronic
1147224013 17:38961124-38961146 ATGCTTAGATTTAAGATATTAGG - Intronic
1148919844 17:51021045-51021067 CTGCTTTGTATTTATAAAATAGG - Intronic
1149375132 17:56036110-56036132 ATGCTTAGTATTCAGAGAATTGG + Intergenic
1151084423 17:71364328-71364350 CTGCATTGATTTAAAAAAATAGG - Intergenic
1152977638 18:238260-238282 CTGCTGAGTTATAAGATAAAAGG + Intronic
1153381383 18:4443516-4443538 CTATTTAGTTTACAGAAAATGGG + Intronic
1156505561 18:37588650-37588672 CTGCTTTGGTTTCAGAAAACTGG - Intergenic
1157619489 18:49008194-49008216 AAGTTTAATTTTAAGAAAATTGG + Intergenic
1158150669 18:54365657-54365679 CTGTTTACTTTTTAGAAATTGGG + Intronic
1158743824 18:60174171-60174193 ATGTTTAATTTTAAGAATATTGG + Intergenic
1158810192 18:61023293-61023315 TTGGTTTGTCTTAAGAAAATGGG - Intergenic
1160468270 18:79101742-79101764 CTCCCTAGCATTAAGAAAATGGG - Intronic
1161885178 19:6989059-6989081 CTGCTGAGTTTTCTGAAATTGGG - Intergenic
1163330059 19:16630467-16630489 CTTCTTAGTTTTTAAAAAGTGGG - Intronic
1163365524 19:16873863-16873885 ATGCTAATTTTTAAGAAAAAGGG - Intronic
1164455620 19:28404184-28404206 CTGCTCTGGTTTAAGAAAATGGG - Intergenic
1165969647 19:39615965-39615987 CTGCTTAGTTGGAACAGAATTGG - Intergenic
1166594030 19:44028491-44028513 CTGCTCAGTTTTAATATCATGGG + Intronic
1167900747 19:52620372-52620394 CTGTTCAGTTCTAAGAAAACAGG + Intronic
926193410 2:10744964-10744986 CGGCCTATTTTTAAGAATATGGG + Intronic
926277541 2:11416222-11416244 CTGCTTAGTTTAGGGATAATTGG - Intergenic
927020372 2:19010476-19010498 CTGCTTAGAATGAAGAAAAGAGG + Intergenic
928037920 2:27843248-27843270 TTGTTTAGTTTTAATATAATAGG - Intronic
928083385 2:28329301-28329323 CTGCATAGTTTTATACAAATGGG - Intronic
929182976 2:39063691-39063713 CTGTATAGTTTTAGGAAAATAGG - Intronic
931073833 2:58686507-58686529 ATGCTTGGATTTAGGAAAATAGG + Intergenic
931404965 2:61967858-61967880 TTGCTCTATTTTAAGAAAATAGG + Intronic
931987745 2:67757698-67757720 CCTGTTGGTTTTAAGAAAATAGG - Intergenic
933010373 2:77054694-77054716 CTGCTTAGTTTCAAGAATCATGG + Intronic
935088671 2:99873174-99873196 CTGTTGAGATTTAATAAAATTGG + Intronic
936953196 2:117998840-117998862 CTGATCATTTTTATGAAAATAGG - Intronic
939137329 2:138313138-138313160 ATGGTTAGCTTAAAGAAAATTGG - Intergenic
939338697 2:140865218-140865240 ATGCTTACTTGTAAGAAAACTGG + Intronic
939765949 2:146250229-146250251 TTGCTTCGTTTTAAGAGACTGGG + Intergenic
939920555 2:148105909-148105931 CTGCTTATTTTGAAAACAATTGG + Intronic
940395186 2:153182008-153182030 CTGCTTATTATTAAGAAAAATGG - Intergenic
940458081 2:153927117-153927139 ATGATAATTTTTAAGAAAATGGG + Intronic
940480003 2:154216455-154216477 TTGCTTCGTATTGAGAAAATGGG - Intronic
940583101 2:155606735-155606757 CTGCTTGGTTTTAACAAAGATGG - Intergenic
941638887 2:167966387-167966409 CTTTTATGTTTTAAGAAAATGGG - Intronic
941651436 2:168096622-168096644 CTGCATATTTCTAAGAAAATAGG - Intronic
942083683 2:172425574-172425596 TTGCTTAGTCCTAGGAAAATGGG + Intergenic
942319353 2:174723046-174723068 CTGCTTAGACTTAGGAAAAATGG - Intergenic
942974690 2:182001462-182001484 CTGCTTTCTTCTAAGAATATAGG + Intronic
943495801 2:188619485-188619507 CTGCCTGTTTTTAAGGAAATAGG + Intergenic
943876608 2:193074171-193074193 CAGCCTAGTTTAGAGAAAATGGG - Intergenic
945150967 2:206791092-206791114 CTGGATGGTTTTAAGAAGATGGG + Intronic
945638004 2:212383311-212383333 CTGATTAATTCTAAGAATATAGG + Intronic
945947078 2:216004724-216004746 CTGTTTAAATTTATGAAAATTGG + Intronic
946221277 2:218229540-218229562 TTTCTTAGTTTTAACAAACTAGG + Intronic
948156279 2:235785218-235785240 CTTCTCACTTTTAAGAAAAATGG - Intronic
948257380 2:236578019-236578041 GTGTTTCGTTTTAAGGAAATGGG + Intronic
1169044117 20:2522262-2522284 CTGCTTAGATTTATCTAAATTGG + Intronic
1169302860 20:4459701-4459723 ATGCTTAGGGTTAAGATAATAGG - Intergenic
1171537885 20:25913375-25913397 GTGTTTATTTTTAACAAAATTGG - Intergenic
1171803303 20:29648428-29648450 GTGTTTATTTTTAACAAAATTGG + Intergenic
1171840818 20:30208685-30208707 GTGTTTATTTTTAACAAAATTGG - Intergenic
1172756395 20:37288012-37288034 CTCCTAAGTTTTAGGATAATTGG - Intergenic
1173877519 20:46384104-46384126 ATGCATATTTTTAACAAAATCGG - Intronic
1175440647 20:58988700-58988722 CCGCTCAGCTTTTAGAAAATCGG - Intronic
1176581194 21:8528703-8528725 GTGTTTATTTTTAACAAAATTGG + Intergenic
1177466780 21:21494904-21494926 GTGCTTATTTTGAAAAAAATTGG - Intronic
1177642346 21:23860236-23860258 TTGCATAGTTTTAAGATAAATGG + Intergenic
1177643612 21:23874738-23874760 CTTCTTAGTTTTAAGAGATTGGG - Intergenic
1180707723 22:17819335-17819357 CTGCTTAGTTTAGACAAACTGGG + Intronic
1183193852 22:36339700-36339722 CTGCAAAGTTTAAAGAAAAAAGG + Intronic
1184963418 22:47948554-47948576 CTGTTCAATTTTAAGAAAATTGG + Intergenic
949969129 3:9387699-9387721 ATGCATATTTTTAAAAAAATAGG + Intergenic
950598994 3:14014816-14014838 CTTAATAGATTTAAGAAAATTGG - Intronic
951586169 3:24217138-24217160 CTACTTAGAGTTGAGAAAATTGG + Intronic
952324655 3:32310013-32310035 CAGCTCAGTTTTTAGAAAAGAGG + Intronic
952329298 3:32349364-32349386 CTGCTTGGTTCTAAGAATACTGG - Intronic
953235924 3:41106794-41106816 CTTTTAAGTATTAAGAAAATTGG - Intergenic
953272431 3:41458588-41458610 CTTCTTAGTATTAAAAAAAAAGG + Intronic
955023872 3:55148294-55148316 CTGCTTATTTTTATGAACACTGG + Intergenic
955155217 3:56410028-56410050 AGGCTTCATTTTAAGAAAATAGG - Intronic
957665931 3:83226937-83226959 ATGCTTAGGTTGAAGAAAATTGG - Intergenic
957994357 3:87670274-87670296 TTGTTTATTTTTAAGCAAATAGG - Intergenic
958266306 3:91441482-91441504 ATGCTTAGTTTGATGAAAAGTGG - Intergenic
958637105 3:96759793-96759815 GTACTTCGTTTTAGGAAAATTGG - Intergenic
961050966 3:123746796-123746818 CTGCCTAGATTTTAAAAAATAGG + Intronic
963519852 3:146349981-146350003 ATGGTTAGTTTTAAGAGAGTCGG + Intergenic
966056089 3:175692217-175692239 ATTTATAGTTTTAAGAAAATTGG - Intronic
967046735 3:185744496-185744518 TTTCTTAGTTTTTATAAAATTGG + Intronic
967253612 3:187567784-187567806 CTGCTTAGCTAAAAGAAATTGGG - Intergenic
967491679 3:190099026-190099048 GTGCTTTTTTTTAAGAAAAAGGG + Intronic
970518200 4:16856082-16856104 TTGTTTCGTTTGAAGAAAATTGG - Intronic
971152501 4:24048501-24048523 TTCCTGAGTTTTAAGAAAATGGG - Intergenic
971537695 4:27774295-27774317 CTGCTTTATTTTAATAAATTTGG + Intergenic
971675070 4:29616053-29616075 CTGTTTTGAGTTAAGAAAATTGG + Intergenic
972711096 4:41595718-41595740 CTCATTATTCTTAAGAAAATAGG - Intronic
973827046 4:54718432-54718454 CTGATTAGTTTTAAAAAATCAGG + Intronic
973952202 4:56027530-56027552 TTCCTTGGTTTTATGAAAATAGG + Intronic
974230146 4:59101792-59101814 CTACTTACATTTAAGAAATTAGG - Intergenic
974289116 4:59908315-59908337 CCCCTGAGTTGTAAGAAAATAGG + Intergenic
974336530 4:60553418-60553440 CTTCATAATTTTAAGAGAATTGG + Intergenic
974880161 4:67746192-67746214 CAGCTTACTTTTAAGCAATTGGG + Intronic
976443639 4:85105353-85105375 CCCCTTAGTAATAAGAAAATAGG - Intergenic
977101289 4:92818581-92818603 CAATTTAGTTTTAAGTAAATGGG + Intronic
977241395 4:94574534-94574556 CTGTTTAATTTTAAGAAAAAAGG - Intronic
977953695 4:103002346-103002368 CAGTTTAGTTTTAAGAGTATGGG - Intronic
978265309 4:106816739-106816761 CTGCTTAGTTTTTATAATGTGGG + Intergenic
978828085 4:113048654-113048676 CTTCTTGATTTTAAAAAAATGGG - Intronic
979367362 4:119841423-119841445 CTTCTTAGTTTTAATAATAATGG + Intergenic
979537354 4:121838425-121838447 GTGCTTAATTTTTAGATAATAGG + Intronic
979939298 4:126739917-126739939 TTTATTAGTATTAAGAAAATAGG - Intergenic
980592995 4:134915909-134915931 CTCCTTAGTTTTAAGGCACTGGG - Intergenic
980884534 4:138747774-138747796 CTGCTGATTCTTATGAAAATAGG + Intergenic
981394566 4:144232970-144232992 ATGCTTAGTTTTAAAGAAAATGG + Intergenic
981733925 4:147928722-147928744 GTGCTTTATTTTATGAAAATGGG + Intronic
982605137 4:157506270-157506292 CTTAATAGCTTTAAGAAAATAGG + Intergenic
983174371 4:164570930-164570952 CTGCTTTATTTCAAGAAAAGCGG - Intergenic
984181797 4:176492466-176492488 CTGTTGAGTTGTAATAAAATAGG + Intergenic
986670189 5:10136622-10136644 CTCATTAGTTTTAAGTACATGGG - Intergenic
987705007 5:21451778-21451800 GTACATAGTTTTGAGAAAATAGG - Intergenic
988181519 5:27800716-27800738 TTGCTTAGTCTTCAGATAATTGG + Intergenic
989309499 5:39998233-39998255 CTGCTTAGCATTGAGAAAATAGG + Intergenic
990208862 5:53459647-53459669 CTCCTTACTTTTTAGAAAAGTGG + Intergenic
992818378 5:80468192-80468214 TAGCTTAATTTTGAGAAAATTGG + Intronic
992946325 5:81814427-81814449 CTGCTGAGTTTAAAGAGAATGGG - Intergenic
993356308 5:86913217-86913239 CTGTTTATTTTTATAAAAATGGG - Intergenic
993881628 5:93369637-93369659 CCACCTAGTTTTAAGAAATTTGG + Intergenic
994225891 5:97250919-97250941 CAGCTCAGTCTTTAGAAAATAGG + Intergenic
994508243 5:100668832-100668854 CTCCTTACTGTTAAGACAATGGG + Intergenic
994914058 5:105949512-105949534 CTGTTAAGTTATAAGAAAATTGG + Intergenic
995050660 5:107699124-107699146 CTACTAATTTTTAAGAATATTGG + Intergenic
995611760 5:113917941-113917963 TTTTTTAGTTTTAAGAAAACTGG - Intergenic
998246242 5:140508439-140508461 CTATTTGGTATTAAGAAAATAGG + Intronic
999110160 5:149112560-149112582 CTTCAGCGTTTTAAGAAAATGGG - Intergenic
1000755449 5:165153063-165153085 TTTCTTATTTTTAAAAAAATTGG - Intergenic
1001260165 5:170221710-170221732 GTTCTTAGGTTTAAGAAAAGGGG - Intergenic
1003501980 6:6710508-6710530 CTGCTCAGTTTGAAGTAGATTGG + Intergenic
1005034667 6:21544574-21544596 CTGCTTTGGTTTCAGAAAAGTGG - Intergenic
1010828890 6:80507071-80507093 TTGCTTATTTTTTAAAAAATGGG + Intergenic
1011888843 6:92131473-92131495 CTCCATAGTTTTAGGGAAATAGG - Intergenic
1012431343 6:99166845-99166867 CGTCTTAGTTTTAAGAATTTGGG - Intergenic
1012654908 6:101805242-101805264 ATGCTTAGTTTTGATAGAATTGG - Intronic
1013488812 6:110624595-110624617 TTGCTTTGTTTTTATAAAATTGG + Intronic
1015346395 6:132164363-132164385 ATGCTTAGTTTACAGAAATTTGG - Intergenic
1015940551 6:138447259-138447281 TTTCTTATTTTTAAAAAAATTGG + Intronic
1016806961 6:148221234-148221256 CTGATTTATTTGAAGAAAATAGG - Intergenic
1017522325 6:155213400-155213422 CTGCTTAGCTTTAAGCAGAGAGG + Intronic
1017522899 6:155217573-155217595 CTGCTTACCTTGTAGAAAATGGG - Intronic
1018598594 6:165512980-165513002 CTGTTGACTTTTAAAAAAATGGG + Intronic
1018700099 6:166419648-166419670 GAGCTGAGTTTAAAGAAAATGGG + Intronic
1018785941 6:167108186-167108208 CATCCTAGTTTTAAGAAAAAAGG - Intergenic
1020386587 7:7611499-7611521 CTGCATAGATTTAAAATAATAGG + Intergenic
1020544458 7:9506706-9506728 CTGAATAGTTTCAACAAAATTGG - Intergenic
1020656539 7:10935183-10935205 CTGCTTAGTTTTAAGAAAATTGG - Intronic
1024096354 7:45985895-45985917 CTAATTAGTTTTAAGCCAATAGG - Intergenic
1024901774 7:54326146-54326168 CTGCCTTGTTTTAAAATAATAGG + Intergenic
1025289336 7:57700204-57700226 GTGTTTATTTTTAACAAAATTGG - Intergenic
1026038802 7:66848481-66848503 CTGGTCAGTTTTCAGAAAAATGG + Intergenic
1026392451 7:69915354-69915376 CTGCTTATTTTTAAAAATAAAGG + Intronic
1027613400 7:80390899-80390921 ATGCATAATTTTAAAAAAATAGG + Intronic
1029027620 7:97433835-97433857 CTGATTGGCTATAAGAAAATAGG + Intergenic
1031345228 7:120657286-120657308 CTGCTTATTTATAATAACATGGG - Intronic
1031393792 7:121247866-121247888 CTGCTTAGCCAGAAGAAAATAGG + Intronic
1031957437 7:127956643-127956665 CTGCTGAGTTCTAAGAACAGGGG + Intronic
1032142891 7:129349824-129349846 CTGCTTTGTTTTGGGAAAAGGGG + Intronic
1032577006 7:133065777-133065799 CTTCTTAGAATTAAAAAAATAGG - Intronic
1033934601 7:146568396-146568418 CTCCTTTGTATTAACAAAATAGG - Intronic
1035829039 8:2674933-2674955 CTACTAAGTCTTAAAAAAATAGG + Intergenic
1036184257 8:6610793-6610815 GTTCTTAGTTTTAAGGAAATGGG - Intronic
1037370472 8:18171848-18171870 CTACTTACTTTTAAGTAATTAGG - Intronic
1037455684 8:19061125-19061147 CTGTGTAGTTATAGGAAAATGGG - Intronic
1039452408 8:37685998-37686020 CAACTCTGTTTTAAGAAAATTGG - Intergenic
1039866218 8:41505379-41505401 CTTCTTAGTTTTGAAATAATGGG + Intronic
1040042000 8:42925562-42925584 CTGCATATTTTGATGAAAATTGG + Exonic
1042219951 8:66463304-66463326 TTTCTTAGTTTTACAAAAATGGG + Intronic
1042735615 8:71984717-71984739 CTGCTGAGGATAAAGAAAATTGG - Intronic
1043095088 8:75958333-75958355 CTGCATACCTTTAACAAAATAGG - Intergenic
1043424712 8:80137026-80137048 CTGCCTACTTTAAAAAAAATTGG - Intronic
1044483027 8:92714987-92715009 CTGCTCACTTTTAGGAAAGTAGG - Intergenic
1045539524 8:103070049-103070071 CAGTTTATTTTTAATAAAATAGG + Exonic
1046188314 8:110752877-110752899 CAGATTAGTTTCAAGAAATTGGG - Intergenic
1049989782 9:979599-979621 TTGCTTTTTTTTAAAAAAATGGG - Intronic
1050097345 9:2080430-2080452 CTGCTTTTTTTAGAGAAAATTGG - Intronic
1053039652 9:34858982-34859004 CTACTTAGTTTAAAGTAAAAGGG + Intergenic
1053426404 9:38013127-38013149 ATTCTTATTTTTAAGAATATAGG - Intronic
1053743136 9:41162704-41162726 CTGCTCATTTTTAAGAACACTGG - Intronic
1054742804 9:68825806-68825828 CTGCTTAATTCTAACAACATTGG - Intronic
1057192852 9:93096918-93096940 CTGTTTAGTTCTAAGAGAATCGG + Intronic
1057411210 9:94817858-94817880 GAGCTGAGTTTAAAGAAAATGGG + Intronic
1058296922 9:103320295-103320317 CTGCTTTATTATAAGAACATAGG + Intergenic
1060717934 9:125951560-125951582 CTGATTTGTTTTAAGAAAAGGGG + Intronic
1061913339 9:133736694-133736716 CTTCTTAGTTTAAAGAATTTAGG - Intronic
1185480921 X:445735-445757 CTGCGAAGTTTGAAGCAAATTGG - Intergenic
1186984944 X:15002411-15002433 CTGCTTATATTTAAGAATGTGGG - Intergenic
1187566574 X:20455957-20455979 GTTCTTAGCTTTAAGGAAATTGG - Intergenic
1187580022 X:20597344-20597366 CTGGTCAGTTGGAAGAAAATGGG + Intergenic
1187609709 X:20928931-20928953 CTCCTTGTTTTTAAGAAAAGTGG - Intergenic
1187699173 X:21948176-21948198 CTCCATAGGTTTAAGGAAATCGG - Intronic
1188409164 X:29850221-29850243 CTGCTAAGGTTTAAGTAAGTAGG - Intronic
1190068717 X:47261631-47261653 CTGCCTAGTTGCAGGAAAATAGG - Intergenic
1191862876 X:65680174-65680196 ATGCTGAGTTTTAAAAAAAGGGG - Intronic
1191995435 X:67090026-67090048 CTTCTAAGTTTTAAGGAAAAAGG - Intergenic
1192373748 X:70538105-70538127 CTGCTTTGTTCTAAGAAGAAGGG + Intronic
1193848073 X:86499612-86499634 CTGCTAAATGTTAAGAAAAATGG + Intronic
1194011462 X:88567426-88567448 CTGAGTAGTTATAAGAAAAGAGG - Intergenic
1194324652 X:92498516-92498538 TTTTTTAGTTTTAAGAAACTGGG - Intronic
1194681359 X:96857908-96857930 TAGCTTAGCTTTCAGAAAATAGG - Intronic
1196372144 X:114991188-114991210 CTGCTGATTTTGAAGAAACTTGG - Intergenic
1197000511 X:121433308-121433330 CAGCTTAGTTTTAAGACTAATGG + Intergenic
1197336217 X:125212147-125212169 ATAACTAGTTTTAAGAAAATAGG - Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1200633388 Y:5617724-5617746 TTTTTTAGTTTTAAGAAACTGGG - Intronic
1201695617 Y:16821264-16821286 TTATTTAGTTTGAAGAAAATAGG + Intergenic