ID: 1020664854

View in Genome Browser
Species Human (GRCh38)
Location 7:11027264-11027286
Sequence ACATAAATGGTATAATATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020664854_1020664856 10 Left 1020664854 7:11027264-11027286 CCAGTATATTATACCATTTATGT 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1020664856 7:11027297-11027319 TTAGAGAAATTATATTAACTAGG 0: 1
1: 0
2: 2
3: 37
4: 460
1020664854_1020664858 25 Left 1020664854 7:11027264-11027286 CCAGTATATTATACCATTTATGT 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1020664858 7:11027312-11027334 TAACTAGGCAGTAGGATGTCAGG No data
1020664854_1020664857 17 Left 1020664854 7:11027264-11027286 CCAGTATATTATACCATTTATGT 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1020664857 7:11027304-11027326 AATTATATTAACTAGGCAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020664854 Original CRISPR ACATAAATGGTATAATATAC TGG (reversed) Intronic
908149035 1:61280818-61280840 TCAAAATTGGTATAATATAATGG + Intronic
911206462 1:95096287-95096309 ACATAAATGGTTCAATACAAAGG - Intergenic
911276231 1:95862528-95862550 ACATAAATAGAAAAAGATACAGG - Intergenic
911538954 1:99135378-99135400 ACATAGATGGTGAAATTTACAGG + Intergenic
911818494 1:102385565-102385587 AGATTAATGTTATAATATTCTGG - Intergenic
911862694 1:102973466-102973488 ACATAAATGGTACAATACTGAGG + Intronic
911874490 1:103142044-103142066 ACATAAATGTTGTAAAATACTGG + Intergenic
911979949 1:104554744-104554766 ACAAAAATGGTAAAATACATAGG + Intergenic
913181379 1:116325732-116325754 ACATAAAATTTATAATACACTGG + Intergenic
914735171 1:150409552-150409574 AAATAAATTGTATAGTATATTGG + Intronic
916272150 1:162954786-162954808 ATATAAATGGAATAATGTAATGG - Intergenic
917550729 1:176025513-176025535 ACAAAAATGGTAACATATATAGG + Intronic
919201681 1:194363063-194363085 AGAAAAATGGTATAAGCTACAGG + Intergenic
919540446 1:198839013-198839035 GCATAAATTGTGTAATATATTGG + Intergenic
919653403 1:200173580-200173602 ATATGAATTGTGTAATATACTGG + Intronic
921118384 1:212115667-212115689 ACATAAATGGTATAAATCAGGGG + Intergenic
921659715 1:217787102-217787124 ACTTAAAAGGTAGAATAAACAGG - Intronic
921824069 1:219652039-219652061 ACTTAAATGAGATAAGATACAGG - Intergenic
1064336115 10:14443625-14443647 ACATATATTATATAATATATAGG + Intronic
1068360048 10:55966283-55966305 GCAAAAATGGGATAAAATACTGG + Intergenic
1068377485 10:56200917-56200939 ATATAAATAGTATAATCAACAGG + Intergenic
1068823077 10:61400894-61400916 ATATAAATGGAATAATACACTGG - Intergenic
1070006789 10:72432440-72432462 ACACAAATGGACTAATACACTGG - Intronic
1071068901 10:81669156-81669178 ATATAATTAGTATAATTTACTGG + Intergenic
1071532159 10:86398709-86398731 ACATATATGATAAAATACACTGG - Intergenic
1071925093 10:90397398-90397420 ACATAACTTGTCTAATATATGGG - Intergenic
1072842595 10:98791673-98791695 AAATAAGTGCTATAATATAGAGG - Intronic
1074179045 10:111041288-111041310 AAATAAATAGTATAACATATTGG + Intergenic
1074962526 10:118460779-118460801 TCATAAATCGTGCAATATACTGG - Intergenic
1075030206 10:119019300-119019322 ACATAAATGGTAGAACAAATTGG - Intergenic
1076292519 10:129358059-129358081 ACACAAATGCTCTAAAATACCGG + Intergenic
1081080959 11:38738787-38738809 ACATATAGGTTAAAATATACAGG + Intergenic
1081115580 11:39194643-39194665 CCATAAAGGGTAAAAAATACAGG - Intergenic
1081391731 11:42537452-42537474 ACAAAACTGGTTTCATATACTGG + Intergenic
1081472215 11:43385142-43385164 ACAAAAATACTATAAAATACAGG + Intronic
1081733547 11:45388011-45388033 ACATTATTGCTACAATATACAGG - Intergenic
1081844798 11:46232442-46232464 AAAAAAATGGTATTATATATTGG + Intergenic
1082192847 11:49267892-49267914 AAATAAATGATAAAATATGCAGG + Intergenic
1082637256 11:55611631-55611653 AAATAATTGTTATATTATACTGG + Intergenic
1086182586 11:83971475-83971497 ACATAAATGTAATAATACAAAGG + Intronic
1086673285 11:89573200-89573222 AAATAAATGATAAAATATGCAGG - Intergenic
1086792617 11:91062012-91062034 ACTTAAAAGGTATATTATTCTGG - Intergenic
1086851851 11:91818517-91818539 ACAAAAATGGTATTACATATTGG - Intergenic
1087310467 11:96536012-96536034 ACATAGATGGAGAAATATACAGG + Intergenic
1087480103 11:98689319-98689341 ACATAAAAAGAATTATATACCGG - Intergenic
1088051578 11:105522056-105522078 AAATAAATGCAATAATATAATGG + Intergenic
1088060970 11:105649861-105649883 ACCTAAATGTTCAAATATACAGG + Intronic
1088089787 11:106023732-106023754 AAATAAATGGTGGAATATTCTGG + Intergenic
1088489771 11:110375565-110375587 TCATAAATGGGATAATGTAAAGG + Intergenic
1088768963 11:113014117-113014139 AGATAAATGGTATACTACACAGG + Intronic
1088929383 11:114334480-114334502 CTATAAAAGGTGTAATATACAGG + Intergenic
1088964301 11:114702567-114702589 GGATAAATGGTATAATACAAGGG - Intronic
1089628936 11:119771436-119771458 ACTTAAAAGGAATAATATCCTGG - Intergenic
1092600352 12:10054447-10054469 ACATAAATGATATAAAATAATGG + Intronic
1092912075 12:13154385-13154407 ACTTAAATCATATTATATACTGG + Intergenic
1093391738 12:18632189-18632211 ACATAAATGTCATAATACATTGG + Intronic
1095886716 12:47195857-47195879 AACTTAATGTTATAATATACGGG + Intronic
1096922712 12:55105237-55105259 ACATAAATGATATAATAAGCGGG - Intergenic
1098065482 12:66611161-66611183 ACATAAATGTGATGATATTCAGG - Intronic
1098196336 12:68005787-68005809 ACAGAAATAGTAGAATACACAGG + Intergenic
1098869120 12:75797085-75797107 ATATAAATGAAATGATATACTGG - Intergenic
1099422293 12:82475991-82476013 ACATTATTGTCATAATATACAGG - Intronic
1099793914 12:87371839-87371861 ATAAAAATGGTATATTAAACAGG - Intergenic
1101057333 12:100932078-100932100 ACAAAAATAGTATAATGAACTGG + Intronic
1102878196 12:116464281-116464303 ACATAAATGGAACCATCTACTGG + Intergenic
1105201018 13:18178036-18178058 AGATAAATGGTGTCATTTACAGG - Intergenic
1107393223 13:39989217-39989239 AAATAAAAGGCATGATATACAGG - Intergenic
1107616605 13:42174653-42174675 ACAGAAATTGCATAATATTCTGG - Intronic
1107803001 13:44127867-44127889 ACATAAATGGAATAATTTAATGG + Intergenic
1108957319 13:56175960-56175982 ACATAATTGGTATCATTTCCAGG - Intergenic
1110914123 13:80999942-80999964 AAATGAATGGTAAAATATGCTGG + Intergenic
1111623748 13:90756937-90756959 ACAGAAAGGATATAATATACAGG + Intergenic
1114946825 14:27692556-27692578 ACACAAAGTTTATAATATACTGG - Intergenic
1114985947 14:28229627-28229649 ACCTATATGGTAGAATATACTGG - Intergenic
1115050711 14:29058910-29058932 ACACAAATGTTCTAATATACAGG + Intergenic
1115175842 14:30560334-30560356 ATTTAAATGGTACAATATCCTGG - Intronic
1115463662 14:33689714-33689736 ACAGAAATTGTATATTATAGAGG - Intronic
1117114641 14:52497160-52497182 TCAAAAATGATATAATAAACAGG + Intronic
1117923434 14:60750064-60750086 ACCTAGATAGTATAAAATACTGG - Intronic
1118069385 14:62229368-62229390 ATATAAAGGGAATAATATACAGG - Intergenic
1119051245 14:71370964-71370986 ACATTAATACTATAATATAAAGG + Intronic
1120964418 14:90155057-90155079 AAATATATGGTATATCATACTGG + Intronic
1124117968 15:26865880-26865902 ACATAAATGTGCAAATATACAGG - Intronic
1126095326 15:45084702-45084724 ACAAAAATGGGATTATATCCTGG + Intergenic
1127428749 15:58881646-58881668 CAATAAATGGTATAATAAAATGG + Intronic
1130068060 15:80621863-80621885 ACATAACTGGCATAATACCCTGG - Intergenic
1130378073 15:83347934-83347956 ACATCAATGGCAAAATATACAGG + Intergenic
1130520200 15:84656098-84656120 ACATAAATGGTCTCATTTAATGG + Intronic
1131296538 15:91154413-91154435 ACAGAAATGGAATATTAGACAGG + Intronic
1137292787 16:47063308-47063330 ACAGAAATGTTATAATTTAAAGG + Intergenic
1139123567 16:64050029-64050051 ACATATTTAGAATAATATACAGG + Intergenic
1139140503 16:64256388-64256410 ACACAAATAGTAAAATATACAGG - Intergenic
1139348308 16:66319159-66319181 GTATAAATGGTATTATATATTGG - Intergenic
1143396875 17:6606720-6606742 AAAAATATGGTATAATATACAGG + Intronic
1146104636 17:30022687-30022709 ATTTAAAAGGTAGAATATACTGG + Intronic
1146715987 17:35087992-35088014 AGAAGAATGGTATAATAAACGGG + Intronic
1147802988 17:43107945-43107967 ACATAAAGGACATAATATACTGG + Intronic
1153409146 18:4774122-4774144 ACAAAAATGGTATGATATAATGG + Intergenic
1153447357 18:5188688-5188710 ACATTTATGGTAGAATTTACAGG - Intronic
1154460634 18:14581297-14581319 ACACATAAGGTAAAATATACAGG - Intergenic
1155235780 18:23817231-23817253 TTATAAATGGTAAAATATAATGG - Intronic
1156850965 18:41725813-41725835 ACAAAAAATGTATACTATACTGG + Intergenic
1157169089 18:45385554-45385576 ACATATATTGAATATTATACGGG - Intronic
1158103332 18:53855831-53855853 ACATAAATGGTAGAAAAAATGGG + Intergenic
1158321787 18:56271211-56271233 TTATAAATTGGATAATATACTGG + Intergenic
1158818628 18:61132692-61132714 AAATAAATGGTAAAATATATTGG + Intergenic
1160303775 18:77711825-77711847 ACATAAATAGCAGAATATTCTGG + Intergenic
1163937463 19:20461982-20462004 AAATAAATTGAATAATATCCAGG - Intergenic
1164959860 19:32418634-32418656 ATAGAAATGGTATAAATTACAGG - Intronic
1167703069 19:51062205-51062227 ACATATATGGAATATTCTACTGG + Intronic
925229289 2:2218340-2218362 AAACAAATTGTGTAATATACAGG + Intronic
925441195 2:3887095-3887117 ACATAATAGGTATAATAACCAGG + Intergenic
928703713 2:33925315-33925337 AGATAAAAGGAATAACATACGGG + Intergenic
931035157 2:58232815-58232837 ACTTAAATAGGATAATACACAGG + Intronic
932291899 2:70588545-70588567 ATATAAATAATATAATATATTGG - Intergenic
932975381 2:76593930-76593952 ACATAAATAGTCATATATACAGG + Intergenic
939066866 2:137493850-137493872 ACACAAAGGGTATCATATCCAGG - Intronic
939451082 2:142375950-142375972 ACTAAAACGTTATAATATACTGG - Intergenic
939519191 2:143208063-143208085 TCATATATGAAATAATATACAGG + Intronic
940302527 2:152190223-152190245 ACATAATTGGCATATTATAATGG - Intergenic
940421264 2:153481638-153481660 ACATGTATGTTATAAAATACTGG - Intergenic
940534359 2:154920771-154920793 ACATAAATTGTATAATTAAGTGG - Intergenic
941343391 2:164336441-164336463 ATATAAAGGGTATACAATACAGG + Intergenic
941416905 2:165232285-165232307 AGATAAATGGTAAAATTTAGTGG - Intergenic
942073213 2:172334000-172334022 ATATAAATGTTATAATAACCAGG + Intergenic
942354253 2:175091078-175091100 ACATATATGTTATTATTTACAGG - Intronic
942623215 2:177871089-177871111 ACATAAAAGGTTTAACATTCAGG + Intronic
943156901 2:184191838-184191860 CCATAAATGGTAAAATTTAGAGG + Intergenic
943629659 2:190237005-190237027 CAATAAATGGTATACTATAATGG + Intronic
945308416 2:208282747-208282769 TCACAAATGGGATAATATAGTGG + Intronic
945571448 2:211473020-211473042 CCATAAATGTTACTATATACGGG + Intronic
945637140 2:212369591-212369613 AAACAAATGCCATAATATACAGG - Intronic
946584632 2:221170930-221170952 AAATAAATGAAATAATCTACAGG - Intergenic
947113078 2:226741027-226741049 ACAGAAAATGTATAAAATACAGG + Intronic
947343532 2:229165683-229165705 ACAACAATGTTATAATAAACAGG + Intronic
948209423 2:236181526-236181548 GCAGAAATGGTGTAAAATACAGG - Intergenic
949068041 2:242005540-242005562 ACATAAGAGTTATTATATACAGG - Intergenic
1170908058 20:20534487-20534509 ACCTAAATTTTAAAATATACTGG - Intronic
1177671764 21:24240654-24240676 ACATAAATAGGCTAATATAAAGG + Intergenic
1177735080 21:25079127-25079149 AAATAATTGGTCTAATATCCAGG + Intergenic
1178020335 21:28401086-28401108 ACATATATTGTATAATTTATTGG - Intergenic
1178773485 21:35527447-35527469 ACAATAATGGTAAAATATACAGG + Intronic
1180667270 22:17523935-17523957 ACATAAATGTTAAAACATAAGGG - Intronic
949276031 3:2282790-2282812 CCATAAATGGAATATTATTCAGG + Intronic
949542178 3:5041451-5041473 ATATAGATAGTATAATGTACTGG + Intergenic
951086972 3:18523582-18523604 AAATAAATGGTGAGATATACAGG - Intergenic
951574344 3:24098247-24098269 CCATAAATGGTAAAAACTACAGG - Intergenic
951688053 3:25366574-25366596 ACATAAAGGAAATAATATACAGG + Intronic
952541113 3:34369348-34369370 ACATAAATGAGAAAATAGACTGG - Intergenic
952781581 3:37105635-37105657 GCATAATTGGTATAATATAGTGG + Intronic
957399554 3:79691134-79691156 GCAAAAATGTTATAAAATACAGG - Intronic
957548003 3:81664953-81664975 ATATAAATTGAAGAATATACAGG - Intronic
958447304 3:94231590-94231612 ACATGAAAGGTTTAATTTACTGG + Intergenic
960135035 3:114096311-114096333 TTATAAATGGCATAATATATTGG - Intergenic
961861940 3:129924130-129924152 ACATAAATGGAAGGATAAACAGG - Intergenic
963095543 3:141535496-141535518 ACAAAAATGGACTAATATAGAGG - Intronic
963385873 3:144593796-144593818 AAATAAATGCTCTATTATACAGG + Intergenic
963418077 3:145024668-145024690 TCAAAAAAGGTATAATATAATGG - Intergenic
965103665 3:164333974-164333996 AAATAAATGGTTAAATATATGGG + Intergenic
966825210 3:183959191-183959213 ACATAAAGGGTTTAAGAAACAGG + Intronic
967628687 3:191716835-191716857 AAATAAATGGGATAATATCTGGG - Intergenic
967631739 3:191751394-191751416 AAATAAATGGCATAAGATAGGGG + Intergenic
968499892 4:944646-944668 ACATAAATGGTACAATAGTATGG + Intronic
969886817 4:10222370-10222392 AAATACATGTTATAATCTACAGG + Intergenic
970325325 4:14917819-14917841 ATATAAATAATATAATATATAGG + Intergenic
971839464 4:31815900-31815922 ACATATATTATATAATATATAGG + Intergenic
971882093 4:32389849-32389871 GCATAAATGGGATAATATAGGGG - Intergenic
971946934 4:33290480-33290502 ACAAAAATCGTATAGTATGCTGG + Intergenic
972448327 4:39169215-39169237 ACATAAACAGTATAAAATATTGG - Intergenic
974215705 4:58843075-58843097 ACGAAAATGGTCTAATACACTGG + Intergenic
974784851 4:66606914-66606936 GGATAAATGGAATAATATCCAGG + Intergenic
975624036 4:76324498-76324520 ACATAAATAATATAAAATATAGG + Intronic
975807358 4:78126695-78126717 ACTTAAATTGTACAATATGCTGG - Intronic
978220143 4:106262134-106262156 ACAAACATGGTATAGTACACAGG - Exonic
978515896 4:109568211-109568233 ATAGAATTGGTATAATAAACCGG + Intronic
981307798 4:143264894-143264916 ACATAATTGCCATAATATTCAGG + Intergenic
981608488 4:146566303-146566325 ACATAAATATTAGAATATATAGG - Intergenic
982565670 4:156983932-156983954 ACATAAAAGGAATCATAGACAGG + Intergenic
982616661 4:157645513-157645535 GCATAAAAGGTAAAATATATGGG + Intergenic
982993393 4:162309077-162309099 ACATAAATTTCAAAATATACAGG - Intergenic
983712271 4:170733306-170733328 ACATAAATGGAATCATACATTGG + Intergenic
984512101 4:180692140-180692162 AAATCAATGGCAAAATATACAGG + Intergenic
984691989 4:182736909-182736931 AATTAAATGGAATAATAGACTGG - Exonic
986460981 5:7972023-7972045 ACTTAAATTGTAAAATATTCTGG - Intergenic
986734432 5:10658155-10658177 ACCTAAATGGTACACTGTACAGG + Intergenic
987728875 5:21741752-21741774 ATATAAATGGAATAATACAGTGG - Intergenic
987804863 5:22751137-22751159 AAATAAATGGTTTAATTTGCAGG + Intronic
988180422 5:27784844-27784866 ACATAAATGGACTAAGACACTGG - Intergenic
988267040 5:28965547-28965569 ATATAAATGGAATAAACTACTGG - Intergenic
989481642 5:41937513-41937535 ACAGAAATGGACTGATATACAGG - Intronic
990799986 5:59590139-59590161 ATATAAATGGAATAAAATGCTGG - Intronic
991321756 5:65381684-65381706 ACAAAAATGGTATAATCCAGAGG - Intronic
991462577 5:66874959-66874981 GCATAGATGATATAATATAAAGG + Intronic
992912083 5:81405776-81405798 ACATAAATGGTACAATAGATGGG + Intergenic
993064307 5:83078888-83078910 ACCTAAAAGGTATAATATAAAGG - Intronic
993691918 5:91012340-91012362 ATATAAATGGTATAAGAAAATGG - Intronic
994129562 5:96209753-96209775 ACATAAAAGGAAAAATATAAAGG - Intergenic
994468342 5:100168875-100168897 ATATAAATATTATAAAATACAGG - Intergenic
994575647 5:101575439-101575461 CCATCAATGCTAAAATATACAGG - Intergenic
994947809 5:106418172-106418194 ACATATATGATATTAAATACAGG - Intergenic
996130339 5:119774169-119774191 ACATAAATGGAAAAATCTAATGG - Intergenic
997193365 5:131960771-131960793 AAATGAATGGTATGATATATTGG - Intronic
998239980 5:140432317-140432339 ATATAAATGGGATCATATAATGG + Intronic
998548808 5:143056502-143056524 ATATAAATGGTGTCATATTCAGG - Intronic
999076718 5:148803332-148803354 AAATAAAAGGTATTAAATACAGG + Intergenic
999985006 5:156995308-156995330 ACATAATTGTAATAATATATGGG - Intergenic
1000841792 5:166229152-166229174 GCATAAATGTTATAATACATAGG + Intergenic
1005889952 6:30128593-30128615 ATATAAATGGGAAAATATAGGGG - Intergenic
1005907369 6:30275771-30275793 ATATAAATGAAATAATATAATGG - Intergenic
1007051289 6:38832991-38833013 AAATCAATGGCATAATATCCTGG - Intronic
1009779538 6:68252237-68252259 AGATAAATGGTATAAAAAATAGG - Intergenic
1011568863 6:88712286-88712308 AAATAAAAGGTATAATAAATAGG + Intronic
1012711467 6:102611638-102611660 ACATACAATGTATAATATATTGG + Intergenic
1012956383 6:105575078-105575100 ACATAGTTTTTATAATATACTGG - Intergenic
1014070056 6:117170616-117170638 GCATTAATGGTATATTTTACAGG + Intergenic
1014703570 6:124719274-124719296 ACTTTAATGGTAGAATATATAGG + Intronic
1016645516 6:146403032-146403054 ACATGAATGGAAAAATATGCAGG + Intronic
1017164938 6:151399211-151399233 AAATAAATGGTAAAATATATAGG + Intergenic
1017890592 6:158635487-158635509 ACATAAATGCTTTAATAAAGCGG + Intergenic
1020381752 7:7555433-7555455 ACATAAATGGAATAGTATAAAGG + Intergenic
1020664854 7:11027264-11027286 ACATAAATGGTATAATATACTGG - Intronic
1021239605 7:18183825-18183847 ACATAAATGGTAAAGTATCCTGG + Intronic
1021419987 7:20435603-20435625 ATATGAATGGTAGAATATTCTGG + Intergenic
1021758659 7:23881653-23881675 ACAGAAATGGTGTTATAAACAGG + Intergenic
1022409591 7:30128664-30128686 ACATAAATGGACTAAGACACAGG - Intronic
1022856421 7:34319252-34319274 AGATAAAAGGTATAATACAAAGG - Intergenic
1024887769 7:54163908-54163930 AAACAAAGGGTATAATATAAAGG - Intergenic
1025031811 7:55563037-55563059 ACATAAACAGTAAAATTTACTGG - Intronic
1026130058 7:67612802-67612824 ACATAAATAGAATCATATAATGG - Intergenic
1026404156 7:70047668-70047690 ACATAGATGGTATAATAACAAGG + Intronic
1027407273 7:77874794-77874816 ACATATGTGGTAAAATATAGGGG + Intronic
1027517446 7:79160430-79160452 AACCAAATGGTATAATATAAAGG + Intronic
1027686460 7:81284847-81284869 TCATAAATGGTAAAAGATAGGGG - Intergenic
1028706433 7:93853323-93853345 ATATAAATGGTAGAATTTATTGG - Intronic
1031443164 7:121818059-121818081 CATGAAATGGTATAATATACAGG + Intergenic
1032925639 7:136601745-136601767 AAATAAATGGAATAAAATATTGG + Intergenic
1034763374 7:153694677-153694699 ACATAAAGTGTATAATTTAGTGG - Intergenic
1037014826 8:13890384-13890406 ACATTAATGGTTTAATATCCTGG + Intergenic
1037210871 8:16385697-16385719 TCATGTATGGTATAATATAAGGG + Intronic
1038160981 8:25037326-25037348 ATATAAATGGATTAATATATTGG + Intergenic
1039297782 8:36175797-36175819 ACATAAATGCCATAATATAAGGG - Intergenic
1040718288 8:50286015-50286037 AAATAAATGGTAGAATAGAAGGG - Intronic
1041326911 8:56677547-56677569 ACAAAAATTGTTTAATTTACAGG - Intergenic
1042831071 8:73029327-73029349 ACAAAAATGGTGTAATAGCCAGG + Intronic
1044203917 8:89469050-89469072 ACATCAATGGTATAAACTTCGGG - Intergenic
1044401848 8:91781786-91781808 ACATAAATTATATAATTTATTGG - Intergenic
1044465505 8:92499090-92499112 AGATAAATGGGAAAATACACTGG + Intergenic
1044979896 8:97706268-97706290 ACAAAAATGTTATAATAATCAGG + Intronic
1046053888 8:109056911-109056933 AAATAAGTGGTACAATATGCTGG + Intergenic
1046336728 8:112799911-112799933 ACAAGGATAGTATAATATACTGG + Intronic
1046594856 8:116249166-116249188 CCACAAATGGAATACTATACAGG + Intergenic
1047949896 8:129923714-129923736 ACATAAATGGTGTACTATCAAGG - Intronic
1050296066 9:4206685-4206707 CCATAAATGAAATGATATACTGG + Intronic
1050451333 9:5784568-5784590 AAATAAACTGTTTAATATACTGG - Exonic
1052884909 9:33635723-33635745 ATAAAAGTGGTATAATATAGGGG + Intergenic
1055830597 9:80373890-80373912 ACATAAAAGGAATAATAGAAAGG - Intergenic
1056160408 9:83885387-83885409 ATATAAATAGTATAATAGGCTGG - Intronic
1056359814 9:85844457-85844479 ATATAAATAGTATAATAGGCTGG + Intergenic
1056850099 9:90076504-90076526 ACATAAAAGGGAAAATATGCTGG + Intergenic
1058246254 9:102629222-102629244 ACATAAATTGTAAAATTTAGAGG - Intergenic
1058271939 9:102983983-102984005 GCATAAATGGTCTAAGAAACTGG + Intergenic
1203583340 Un_KI270746v1:35900-35922 AGATAAATGGTGTCATTTACAGG + Intergenic
1187062289 X:15798636-15798658 AATTCAATGGTATCATATACAGG + Intronic
1187769134 X:22676155-22676177 AAATGAATGTTAAAATATACGGG - Intergenic
1188066940 X:25673704-25673726 ACAAAAATGGTAAAATATTTGGG - Intergenic
1188191739 X:27179829-27179851 ACATAAATAGAATAATAAAATGG + Intergenic
1189089451 X:38065081-38065103 ATATAAATGTTATAATTTCCAGG - Intronic
1189981775 X:46518174-46518196 ACAGAAATGGCAAAATATATGGG + Intronic
1192119400 X:68440613-68440635 ACATAAATGATCTCATTTACAGG + Intergenic
1192301685 X:69911017-69911039 ACATACTTTGTATTATATACTGG + Intronic
1193012441 X:76691980-76692002 TCATAAAAGGTATAATAAAGAGG - Intergenic
1193187221 X:78527784-78527806 AGATAAATAGAATAATATTCTGG - Intergenic
1193224199 X:78962423-78962445 GCATATATGGTGTATTATACTGG - Intergenic
1193464826 X:81835578-81835600 ACAGAAAGGGTATAAGATAGAGG - Intergenic
1193752003 X:85357278-85357300 AGACAAATGGGATAATATTCTGG - Intronic
1194128059 X:90044833-90044855 ACACAAAAGGTATAATCTAATGG + Intergenic
1194180347 X:90704039-90704061 ACTTAAATGGTAAATAATACAGG + Intergenic
1194765449 X:97842847-97842869 ACCTAAATTGTTTGATATACAGG - Intergenic
1194860027 X:98986533-98986555 TCAGAAATGATATAATATATTGG - Intergenic
1195906178 X:109846767-109846789 AGATAAATGGGATAATATCCAGG + Intergenic
1196417903 X:115492557-115492579 AATTAAATGGTATAATTCACTGG - Intergenic
1197115921 X:122833632-122833654 CCATACATGGTATAAAATAAGGG + Intergenic
1197425286 X:126289101-126289123 ACATAAATGATACAATTCACAGG - Intergenic
1200527010 Y:4286199-4286221 ACTTAAATGGTAAATAATACAGG + Intergenic
1200655398 Y:5895722-5895744 ACATCAATGGTAGACTAGACTGG + Intergenic