ID: 1020664855

View in Genome Browser
Species Human (GRCh38)
Location 7:11027277-11027299
Sequence TAATAACAGTAGAACATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 403}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020664855_1020664856 -3 Left 1020664855 7:11027277-11027299 CCATTTATGTTCTACTGTTATTA 0: 1
1: 0
2: 1
3: 46
4: 403
Right 1020664856 7:11027297-11027319 TTAGAGAAATTATATTAACTAGG 0: 1
1: 0
2: 2
3: 37
4: 460
1020664855_1020664858 12 Left 1020664855 7:11027277-11027299 CCATTTATGTTCTACTGTTATTA 0: 1
1: 0
2: 1
3: 46
4: 403
Right 1020664858 7:11027312-11027334 TAACTAGGCAGTAGGATGTCAGG No data
1020664855_1020664857 4 Left 1020664855 7:11027277-11027299 CCATTTATGTTCTACTGTTATTA 0: 1
1: 0
2: 1
3: 46
4: 403
Right 1020664857 7:11027304-11027326 AATTATATTAACTAGGCAGTAGG 0: 1
1: 0
2: 0
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020664855 Original CRISPR TAATAACAGTAGAACATAAA TGG (reversed) Intronic
901592357 1:10356064-10356086 TAAAAAAAATACAACATAAACGG + Intronic
902903479 1:19536586-19536608 TAATAACATTAGAAACTAGAAGG + Intergenic
902913505 1:19620208-19620230 TCATAACAATAAAACATGAAAGG - Intronic
903347040 1:22693089-22693111 TAATAAAAGTAAAACAAAACAGG + Intergenic
907829813 1:58054021-58054043 GAATAACACTAGAACTAAAAGGG + Intronic
908462504 1:64359006-64359028 TAATAACAAAAGAACATGAGGGG + Intergenic
909002243 1:70232750-70232772 AAATAACAGGAAAAGATAAAGGG - Intronic
909255883 1:73420834-73420856 TAATCATAGTATAACATAAATGG + Intergenic
909351975 1:74664724-74664746 TAATAACAGTCGCATAAAAATGG + Intronic
909749939 1:79146701-79146723 TAATAAAAGTAGAAGATACTTGG + Intergenic
909833322 1:80222042-80222064 TAAACACAGTAGAACAAAAATGG + Intergenic
909851190 1:80466319-80466341 TAATAAAAGGGGAAAATAAAAGG - Intergenic
910894890 1:92058688-92058710 TAATAATAATAAAACATCAAGGG + Intronic
910998157 1:93131515-93131537 TAATAACAGTAGTAAAGGAAAGG + Intronic
911810616 1:102273461-102273483 AAATGAAAGTAGAACATACAGGG - Intergenic
911862168 1:102966360-102966382 TAATAAGATTAGAAAAAAAATGG + Intronic
912075497 1:105870302-105870324 AAATAACAGTTGAAAGTAAAAGG - Intergenic
912646364 1:111395887-111395909 TATTAACATTAAAATATAAATGG + Intergenic
912666297 1:111582959-111582981 TAATAACTGCAGAGCATGAAGGG + Intronic
912725247 1:112053530-112053552 TAATAACAGTAAAATTTACAAGG + Intergenic
913197424 1:116469571-116469593 TAATATTAAAAGAACATAAAAGG + Intergenic
914001133 1:143695306-143695328 TAATAAAAGAAAAACACAAATGG + Intergenic
914840770 1:151246899-151246921 TACTAACAGGAGAAAAAAAATGG - Exonic
915048801 1:153045123-153045145 AAATAAAAGTAGAATATATAGGG - Intergenic
915050199 1:153061618-153061640 AAATAACAGTAGAATCTATAAGG - Intergenic
915051312 1:153076263-153076285 AAATAAAAGTAGAATTTAAAAGG - Intergenic
915085699 1:153387171-153387193 TAGTAACAGGAGTACAAAAAAGG - Intergenic
916396043 1:164388523-164388545 TAATAGTAATAGAACAAAAAAGG - Intergenic
916966592 1:169951844-169951866 TGCTAAAAGTAAAACATAAATGG + Intronic
917494360 1:175526638-175526660 TAATAACATTAGAATTTAAATGG - Intronic
917693563 1:177494891-177494913 TTCTATCAGTAGAACATAAGAGG - Intergenic
918094413 1:181322701-181322723 CAATAACACATGAACATAAACGG - Intergenic
918842593 1:189561461-189561483 CAATAACGGTAGACCATAAGAGG - Intergenic
918844174 1:189587292-189587314 CAATAAGAGAAGAACAAAAAGGG - Intergenic
918960716 1:191273400-191273422 TAATAACAGTAAAACTAAAAAGG + Intergenic
919041019 1:192388335-192388357 TAATAACAATAAAACAGATATGG + Intergenic
919224140 1:194672641-194672663 TAATAATAGTTGTACATAAGGGG + Intergenic
919543668 1:198883897-198883919 TAATATCAGTAAAAACTAAATGG + Intergenic
920166209 1:204037778-204037800 CAATAACAGCAGAACACACAAGG + Intergenic
924033543 1:239911716-239911738 TAAAACCAGTAAAACAAAAAAGG - Exonic
924703045 1:246473656-246473678 TAATAACAATATGTCATAAATGG - Intronic
1063070897 10:2662972-2662994 TAATTATAATAGAATATAAAAGG - Intergenic
1066131696 10:32400742-32400764 CTATAACTGTAGAACCTAAATGG + Intergenic
1066590685 10:36990671-36990693 TGATAAAAGTATAAAATAAAAGG + Intergenic
1067234025 10:44433043-44433065 TACTAACAGTTGAATGTAAATGG - Intergenic
1067269611 10:44778808-44778830 TAATGATAGTAGAAAAAAAATGG - Intergenic
1067678430 10:48408309-48408331 TAACAACATTAGAAGATAACTGG + Intronic
1069007149 10:63330424-63330446 TTAGAAAAGTAGAACATGAATGG - Intronic
1069103221 10:64350292-64350314 TATTATAAGTAGAAAATAAATGG + Intergenic
1069649689 10:70036549-70036571 TAATAACAGAACATCATAAGGGG + Intergenic
1070183272 10:74035340-74035362 TAACAACAGCAGAAGACAAAAGG + Intronic
1070951018 10:80430687-80430709 TAAAAACAGCAGAACATAGAAGG + Intronic
1071096319 10:81979324-81979346 TAACAATAATATAACATAAAAGG + Intronic
1071195838 10:83158359-83158381 TTATACCAGAAGAAAATAAAGGG - Intergenic
1074355789 10:112781930-112781952 TAATACCTGTAGCAGATAAATGG - Intronic
1075110972 10:119584039-119584061 TAATCACAGCAAAACATACAGGG + Intronic
1075389393 10:122081998-122082020 TAATAAGAGTAAATCATAACAGG - Intronic
1075681017 10:124331376-124331398 AATTAACAGTCAAACATAAATGG + Intergenic
1077771416 11:5223008-5223030 TAATAACACTAGAAAATCTAGGG + Intergenic
1077801570 11:5544111-5544133 GAATTACAGTGAAACATAAAAGG + Intronic
1077990420 11:7405127-7405149 TAATAAAAGTCAAATATAAAGGG - Intronic
1078933729 11:15934518-15934540 GAATAAGAATAGAAAATAAAGGG - Intergenic
1079671261 11:23174378-23174400 TATTAATATTAGAACATAATTGG + Intergenic
1079999633 11:27333088-27333110 AAAAAAAAGTAGAACTTAAAGGG - Intronic
1080116345 11:28625276-28625298 TTATAAGAGAAGAACATAACAGG + Intergenic
1080141127 11:28921579-28921601 TTATAACAGTGGATCATCAATGG + Intergenic
1080407563 11:31993250-31993272 TAATAACAGGGGAAAATAAAAGG - Intronic
1080899689 11:36477565-36477587 TGAATACAGCAGAACATAAATGG - Intergenic
1080963437 11:37186759-37186781 TCATAACATTAGAACAGAGAAGG - Intergenic
1082858065 11:57827213-57827235 TAAAAAAAGTAAAACAAAAAAGG + Intergenic
1084756017 11:71239165-71239187 TACAACCAGTAGAACAGAAAGGG - Intronic
1085163713 11:74375401-74375423 TAATAACAGTAAGACTTACATGG + Intronic
1086088185 11:82977798-82977820 TAATAACATTCCAACATCAAGGG + Exonic
1088072503 11:105806807-105806829 CAAGAACAGGAGACCATAAAAGG + Intronic
1090115784 11:123971539-123971561 TAATAAGATTAGAGCAGAAATGG - Intergenic
1090159717 11:124480045-124480067 TAATAACAATAGGGCATAAAGGG - Intergenic
1090798918 11:130158984-130159006 AGAATACAGTAGAACATAAATGG + Intergenic
1091000027 11:131902851-131902873 TAATAGCAGTTGTATATAAAAGG - Intronic
1092147005 12:6221661-6221683 TAATAATAGGAGAAACTAAATGG - Intronic
1092967971 12:13663205-13663227 TAGTCATAGTTGAACATAAAGGG - Intronic
1094049678 12:26205343-26205365 TAATGACAGGAGACCAGAAAAGG + Intronic
1095240846 12:39857136-39857158 AAATAACAGAACAAGATAAAGGG - Intronic
1096428885 12:51527002-51527024 TAATAACTGGATAACATCAAGGG + Intergenic
1096929990 12:55197260-55197282 TAATAACTGGAGAAAATGAAAGG + Intergenic
1097473406 12:60023397-60023419 TAATAAAAATATAAAATAAAAGG + Intergenic
1097511312 12:60545474-60545496 TAATGACAGTAAAATATCAATGG + Intergenic
1097559597 12:61186371-61186393 TAATAGAAGGAGAAAATAAATGG + Intergenic
1097604145 12:61731674-61731696 TAATAGCAGTAAATCATAAATGG - Intronic
1097856745 12:64471647-64471669 TAAAAACAGTAGAAGAGACAGGG - Intronic
1098062416 12:66577394-66577416 TAGTGAAAGTAGAACACAAAGGG + Intronic
1098703835 12:73662792-73662814 TAATCATGGTAGAAGATAAAGGG - Intergenic
1098716930 12:73840818-73840840 TAATAACATTTAAACAGAAAAGG - Intergenic
1099154598 12:79158595-79158617 TAATAATAATAGATGATAAAAGG + Intronic
1099363908 12:81743699-81743721 TCATCACAGTAGAGGATAAAAGG + Intronic
1099484889 12:83216839-83216861 TAATAACTTTAAAACATAGATGG - Intergenic
1100419268 12:94415556-94415578 TAATAAAAGTAGATTTTAAAAGG + Intronic
1101982513 12:109419912-109419934 TAATTACATTAGAAAGTAAATGG - Intronic
1102465091 12:113125441-113125463 TAATATGAGTAGACAATAAATGG + Intronic
1102592146 12:113964966-113964988 TCACAACATTAGAACAGAAATGG + Intronic
1104073170 12:125364384-125364406 TAAGAACAGTAAAATATTAATGG - Intronic
1107474687 13:40724365-40724387 TAATAAGAGTAAATCTTAAAGGG - Intergenic
1108101796 13:46964874-46964896 TAATTACAGAAGACAATAAATGG + Intergenic
1108557502 13:51609286-51609308 AAATAACAGCAGGAAATAAAAGG - Intronic
1108857742 13:54816325-54816347 TAAACACAGTAGAAAATAAAGGG + Intergenic
1108932622 13:55846830-55846852 AAATAACTGTAGAATATATATGG + Intergenic
1109011359 13:56949852-56949874 TACTAACATTAGTAAATAAAAGG - Intergenic
1109252799 13:60040602-60040624 TAATAGTAGTAGTAAATAAAGGG + Intronic
1109523957 13:63550667-63550689 TACTAAAATTAGAATATAAATGG - Intergenic
1109732186 13:66427874-66427896 TACTAACAATAGAAAATTAATGG + Intronic
1109778502 13:67076179-67076201 TAATAACAGTAAAATATTTAGGG - Intronic
1109955086 13:69555204-69555226 TCATAATAGTAGAATATTAAGGG - Intergenic
1109960262 13:69620021-69620043 TAATAACATTAAAACTTAAAGGG + Intergenic
1110323791 13:74190417-74190439 TGATAACAGTTAAACATCAAAGG - Intergenic
1111259831 13:85722941-85722963 CATTAACAGTAGAACCAAAAAGG + Intergenic
1111369873 13:87303454-87303476 CCATTACAGTAAAACATAAATGG + Intergenic
1111370291 13:87308103-87308125 TATTAACAATAGCAAATAAATGG + Intergenic
1111608600 13:90574962-90574984 TAATTTCATTAGAACAAAAATGG - Intergenic
1113234018 13:108249174-108249196 AAATAAGAGTAGAAGAGAAATGG + Intergenic
1113238412 13:108309124-108309146 TAATCACAGTAGAAGGCAAAAGG + Intergenic
1114962904 14:27917741-27917763 AAAAAAGAGTAGAACATAAGTGG - Intergenic
1114968423 14:27995051-27995073 TTATAAGAGAAGCACATAAAAGG - Intergenic
1115062313 14:29208012-29208034 TAATAACAGTAGATCACTAGAGG - Intergenic
1116347235 14:43809804-43809826 TAGTAAGAGTAGTACATAATAGG - Intergenic
1116826074 14:49675057-49675079 TCATAAGAGTAGTACATATAGGG - Intronic
1117355691 14:54921661-54921683 TAATAACAATAAAAGAAAAAAGG - Intergenic
1117484413 14:56180047-56180069 GTATAAAAGTAAAACATAAAAGG - Intronic
1117682443 14:58218427-58218449 TAGTAACAATAGTACATATATGG - Intronic
1119008031 14:70951834-70951856 TAAAAACATAAGAAAATAAATGG - Intronic
1120546009 14:85812399-85812421 TAATAACAGTACAATATAGCAGG + Intergenic
1121746688 14:96301078-96301100 TGATAATTGCAGAACATAAATGG - Intronic
1121886415 14:97547042-97547064 TAATAACAGCAAAAAAAAAATGG + Intergenic
1124705218 15:31958240-31958262 TATACACAGTAGAAGATAAAGGG - Intergenic
1126306579 15:47265493-47265515 TAATTAAAGTAAAACAAAAAAGG - Intronic
1126350410 15:47739970-47739992 TATTAAAAGTAGAAAATAATTGG - Intronic
1127398766 15:58564738-58564760 TAATAATAATAGAAAAGAAAAGG + Intronic
1128973702 15:72132309-72132331 TATTAACAGCAGAACAATAAAGG + Intronic
1129327867 15:74811172-74811194 TAATAAAAGTAGAAGATATAAGG + Intergenic
1130195491 15:81776887-81776909 TAATAACAGATGAACATGACTGG - Intergenic
1130666029 15:85870728-85870750 TAAAAACAGAAAAAAATAAAAGG - Intergenic
1130758498 15:86792283-86792305 TAATCAAATTAGAACATGAAAGG - Intronic
1131794616 15:96002584-96002606 TAATAACAGTTTTACACAAAGGG + Intergenic
1133343536 16:5054975-5054997 TAAAAACAGTACAATACAAATGG + Intronic
1133544838 16:6795886-6795908 TAAAAACATAAGAACATAAAAGG - Intronic
1135735250 16:24926167-24926189 GAAAAAAAGTAGAATATAAATGG + Intronic
1136604997 16:31327610-31327632 TAATAATAATAAAAAATAAAAGG + Intronic
1137258348 16:46797660-46797682 TAAGAAAATTATAACATAAAGGG + Intronic
1137264295 16:46856175-46856197 TTAAAACAGTAGAAAATAAAGGG + Intergenic
1137548335 16:49419172-49419194 TAATGACAGGAGACCATGAAAGG + Intergenic
1138045404 16:53718510-53718532 TAATAATAGAAGAAAAAAAAAGG - Intronic
1138168692 16:54828711-54828733 AAATAAGAGCAAAACATAAATGG - Intergenic
1139014288 16:62671151-62671173 TAATAACATTAAAAATTAAATGG + Intergenic
1139016704 16:62697960-62697982 TAATAACTGGAGAAAGTAAATGG + Intergenic
1139718867 16:68836863-68836885 TAAAAACAGTTGAAAATAAATGG - Intergenic
1139755233 16:69137447-69137469 TACTAACATTATAACCTAAATGG - Intronic
1140589080 16:76329748-76329770 TAGTAACAGTATAAAATAAAAGG + Intronic
1145853870 17:28133417-28133439 TAGTAACAGGAGAACGTTAAGGG - Intronic
1146036317 17:29410005-29410027 TAATAAGACTAGAACAAAACAGG - Intronic
1146292048 17:31615227-31615249 TAAAAAGCGTAGAAAATAAAGGG + Intergenic
1150881617 17:69035471-69035493 TGAGAACAGTAGCACAAAAAAGG + Intronic
1153816172 18:8792290-8792312 TCATGGCATTAGAACATAAAAGG + Intronic
1155232583 18:23788266-23788288 TAATAACAATAGTACAAAAATGG + Intronic
1155445656 18:25910471-25910493 TAACAACAGTTGTACAAAAAAGG - Intergenic
1155600269 18:27537882-27537904 TAATAAAAGTAGAAAAGACATGG + Intergenic
1156315122 18:35962497-35962519 TATTAACAGTAGAGTCTAAAGGG + Intergenic
1156557975 18:38088909-38088931 AAATAACTGTAGAACAAAATGGG - Intergenic
1156708804 18:39916516-39916538 AAAGAACCGTGGAACATAAAAGG + Intergenic
1156785809 18:40913640-40913662 AAATATCAGTAAAACATAGATGG - Intergenic
1157086938 18:44590211-44590233 TAATAACAGCAGAAGAATAAAGG - Intergenic
1158610717 18:58937922-58937944 AAATAACAATAGAGAATAAAAGG - Intronic
1159275254 18:66210919-66210941 GAAGAAAAGTAGAAAATAAAGGG - Intergenic
1159512043 18:69407249-69407271 TAGAAACTGTAGAAGATAAAAGG + Intronic
1159575905 18:70177105-70177127 TACAAACAATAGAATATAAAAGG + Intronic
1161568574 19:5017194-5017216 TAATCGTAGTAGAACAGAAAAGG - Intronic
1165650727 19:37486652-37486674 TAAAAATGTTAGAACATAAATGG + Exonic
1166376367 19:42329490-42329512 TAAGAACAGAAGATCATCAAGGG - Intronic
1168525063 19:57082052-57082074 TAATAATAATAAAATATAAAAGG + Intergenic
926442582 2:12905857-12905879 TATTAACAGTAGGACATATATGG + Intergenic
926838804 2:17055176-17055198 TAATAACAATAGTACAAAGAAGG + Intergenic
927165236 2:20313384-20313406 TAAGAACAGTACAACCAAAAAGG + Intronic
927695020 2:25233970-25233992 TGAAAAGAGTAGAAAATAAAAGG + Exonic
927795748 2:26047189-26047211 TAATTACAAAAGAACATGAAGGG - Intronic
929096900 2:38271420-38271442 TTATAACAGTAAATTATAAAAGG - Intergenic
929492980 2:42413568-42413590 TAATAAAAATACAAAATAAAAGG - Intronic
929594017 2:43164704-43164726 AAATAACATTAGAAGAGAAAGGG + Intergenic
929801250 2:45105042-45105064 TAATATCAGGAGAACTTAATGGG - Intergenic
929927198 2:46223752-46223774 TAATTACAGTAGAACATGGAAGG - Intergenic
930426411 2:51218249-51218271 TAATCCCAGAAGAAAATAAATGG - Intergenic
935953651 2:108353197-108353219 AAATATCAGTAGGACATGAAAGG + Intergenic
936638485 2:114286249-114286271 CAACAAAATTAGAACATAAATGG + Intergenic
936696946 2:114961960-114961982 TAATAATAATAAAAAATAAAAGG + Intronic
937808750 2:126176079-126176101 AAATAAAAGAAGAATATAAAAGG - Intergenic
939447310 2:142326920-142326942 TAATAATTTTAAAACATAAATGG + Intergenic
939455253 2:142426255-142426277 TAATCACAGCAGAAGCTAAATGG + Intergenic
940998331 2:160174731-160174753 ATATTACAGTAGAACACAAAGGG + Intronic
941253452 2:163197125-163197147 TAAAAACTGTAAAACATTAATGG - Intergenic
941304966 2:163853170-163853192 GAATAACAGTAGAAAATACAAGG - Intergenic
941912683 2:170780388-170780410 TTTTAACAGTAAGACATAAATGG - Intergenic
942187954 2:173442562-173442584 AAATAACAGAAGCACAAAAAAGG + Intergenic
942503398 2:176616249-176616271 TAATAACATTACAAAAAAAAAGG - Intergenic
943531356 2:189085215-189085237 TAATAACAGAACAAAACAAAAGG + Intronic
943534190 2:189126675-189126697 TAATAACAGCATAACAAAAATGG + Intronic
943771176 2:191719459-191719481 AAATCACTGTAGAACAGAAAAGG + Intergenic
943918535 2:193671007-193671029 TAATAACAATAGTACAAAAAGGG + Intergenic
943975325 2:194469392-194469414 TCATAACAATAGAAGAAAAAAGG + Intergenic
944304123 2:198158981-198159003 TGATGCCAGTAGAACAGAAATGG - Intronic
944397958 2:199290807-199290829 TACTATCACTAGAACTTAAAGGG + Intronic
945092767 2:206191365-206191387 TAAAAGCAGTAGAGAATAAAGGG + Intronic
945202755 2:207299846-207299868 TAATAACAGTGGAAATTATATGG + Intergenic
945504132 2:210616990-210617012 TAAAAACAGTAGAGCGCAAAAGG - Intronic
945632245 2:212294137-212294159 AAATAAAAGTAGAACAGAAATGG - Intronic
945638712 2:212394481-212394503 TGATAACAGGAAAATATAAATGG - Intronic
945909305 2:215629606-215629628 TAATAAGCGTAGTACATAATAGG + Intergenic
946791789 2:223308466-223308488 TAACTACAGTAGATCATCAAAGG + Intergenic
947441548 2:230126366-230126388 TAATAACAGCTGAAAATAGAAGG - Intergenic
947492263 2:230604925-230604947 CAATAACCAGAGAACATAAATGG + Intergenic
947920999 2:233873959-233873981 TGAAAACAGTTGAACATAAAGGG - Intergenic
948013156 2:234666249-234666271 TAATAACAGGATAAAATAAATGG - Intergenic
1168736821 20:147464-147486 TCATAACAGTGGAGCACAAATGG - Intergenic
1168864165 20:1070524-1070546 TAATAACAAAAGAATTTAAATGG - Intergenic
1169014718 20:2282292-2282314 TAGTAACAAGAGAAGATAAAAGG + Intergenic
1169477079 20:5941250-5941272 TACTGACAGTAGACCACAAACGG + Exonic
1169699800 20:8433304-8433326 TAATAACTGTAGAACAAGAAAGG + Intronic
1170518791 20:17161287-17161309 TGATGACAGTAGAAAAAAAAAGG - Intergenic
1171989155 20:31682419-31682441 TAATAACAGAATCACATATAAGG - Intronic
1173034516 20:39395803-39395825 TAATAACAGTGGAAGGTCAAAGG + Intergenic
1173716639 20:45212985-45213007 GAATAACAGTCGGACACAAAAGG - Intergenic
1174144489 20:48441817-48441839 TAATAAGAGTGGATCAAAAAAGG + Intergenic
1177947836 21:27494196-27494218 AAATAACATTAGAAAAGAAAGGG - Intergenic
1178080137 21:29054942-29054964 TATTGACAGCAGAATATAAATGG + Intergenic
1178149409 21:29776950-29776972 CAATACCAGAAGAAAATAAAGGG + Intronic
1178596456 21:33957731-33957753 TAATAACAATAGAAATAAAAGGG - Intergenic
1181890893 22:26062598-26062620 TAATAATAGTAAAATAAAAATGG - Intergenic
1182054530 22:27339673-27339695 TAATCAAATTAGAAAATAAAAGG - Intergenic
1183039959 22:35170542-35170564 TAATTACAGTAGGATACAAATGG + Intergenic
949283934 3:2379265-2379287 TAAAAACAGAAGAAAAAAAAAGG - Intronic
949330113 3:2912626-2912648 TAATAACTGTACAGTATAAAAGG + Intronic
950079412 3:10210465-10210487 TAAAATCAGAAGAAAATAAATGG - Intronic
950235530 3:11317003-11317025 TAATAAAAATACAACAAAAAAGG - Intronic
950374643 3:12560923-12560945 TAAGATCAGTATAACATAGATGG + Intronic
950671405 3:14528041-14528063 TGACTACAGTAGAACATCAAGGG - Intronic
953216798 3:40926247-40926269 TAATAACAGTTGGAAATTAATGG - Intergenic
953590559 3:44248754-44248776 GAATAAAAGTAGAAGATGAAAGG + Intronic
954929069 3:54264577-54264599 TATTAACAGTAAAATAGAAACGG + Intronic
955865482 3:63378763-63378785 AAATAACAGTAGAAAAAAAAAGG - Intronic
956484418 3:69706955-69706977 TTATAACAGTGAAACATAAAAGG + Intergenic
956543556 3:70372916-70372938 TAAAAATAATAGAACTTAAAAGG - Intergenic
957253317 3:77803522-77803544 TAATTACAGTAGAACATAGTTGG + Intergenic
957809257 3:85196924-85196946 TACTCAAATTAGAACATAAATGG + Intronic
958612231 3:96441287-96441309 TAATTAAAATAGAACATGAAGGG - Intergenic
958726820 3:97916064-97916086 TAATAACAATAGCACTTACAAGG + Intronic
959067258 3:101670198-101670220 TAAAAACAATAAAGCATAAAAGG + Intronic
959323609 3:104908563-104908585 TAATAAAAATAAAAAATAAATGG + Intergenic
959622466 3:108412987-108413009 TAATAACTAAAGAAAATAAAGGG - Intronic
960094566 3:113676872-113676894 TAATAACAGTATTACATTATTGG + Intronic
960323932 3:116271631-116271653 TACTAACAGTAGAAAACAAATGG + Intronic
960547438 3:118932209-118932231 AAATAACAGTAGATCAAAATAGG + Intronic
960699592 3:120427223-120427245 TCATACCAGTAGAAAGTAAAAGG - Intronic
960748645 3:120919793-120919815 TAATCACATTAAAATATAAATGG - Intronic
961679990 3:128593454-128593476 TAATAATAGTAATACAGAAATGG + Intergenic
962244920 3:133784498-133784520 TAATAATAATAGGACATAAATGG + Intronic
962439936 3:135404196-135404218 AGATAAGAGTAGAACATACATGG + Intergenic
963822903 3:149918833-149918855 AAATAAAAGTAAAAAATAAAGGG - Intronic
964097199 3:152946133-152946155 TAAACACAGTAGTGCATAAATGG - Intergenic
965076556 3:163986535-163986557 TAATAAAAATATAAAATAAAAGG - Intergenic
965762100 3:172090180-172090202 TAACAACAGTAGCAGAAAAAAGG - Intronic
966100358 3:176261682-176261704 AAATCAAACTAGAACATAAAAGG - Intergenic
966589761 3:181669023-181669045 TAATTACAGTGTATCATAAAAGG + Intergenic
967254543 3:187576291-187576313 TAATAAATGTAAAACAAAAAGGG - Intergenic
969639066 4:8386144-8386166 TAATAAAATCAAAACATAAATGG - Intronic
970609479 4:17711695-17711717 GAATAACAATAGATAATAAAGGG + Intronic
970766895 4:19560424-19560446 TTAAAACAGTAGTTCATAAATGG - Intergenic
970928388 4:21480740-21480762 TAGAAACTGTAAAACATAAATGG + Intronic
971511451 4:27430304-27430326 TGATAACAGTAGCATATGAATGG + Intergenic
972012233 4:34199289-34199311 AAATTACAGTATAACATAAAAGG - Intergenic
973037943 4:45430874-45430896 GAATAACAGTAAAACATAATGGG + Intergenic
973900701 4:55467431-55467453 TCATGACAGTAGTACATACAAGG + Intronic
974476749 4:62391698-62391720 AAATTACAGTAGTATATAAAAGG - Intergenic
974611270 4:64220369-64220391 TAATAACAATAAAATAAAAATGG - Intergenic
975368748 4:73558863-73558885 TAATCACAGAAGAACTAAAAGGG - Intergenic
976121055 4:81782086-81782108 TATTAACTGTAGAACAAAAAGGG + Intronic
976208079 4:82640761-82640783 TAATAACACTCAAACATGAATGG + Intronic
976866715 4:89737333-89737355 TAAACAAAGTAGAGCATAAATGG - Intronic
977352184 4:95902530-95902552 TAATATCAGTAGAGGAAAAAGGG + Intergenic
977662193 4:99602619-99602641 TAAAAACAGTAGTACTGAAAAGG + Intronic
979001353 4:115224697-115224719 TAAAAAGAGAAAAACATAAAGGG + Intergenic
979216995 4:118177616-118177638 TAACAACAAAAGAACATGAATGG + Intronic
979416950 4:120453440-120453462 TAATAATAGTACATCATACAGGG - Intergenic
980170416 4:129282833-129282855 TAAGAACTGTAAAAAATAAAAGG - Intergenic
980621424 4:135310290-135310312 TAATAAAAATAGAATCTAAATGG + Intergenic
980681155 4:136162769-136162791 AAATCACAATAGAACTTAAATGG + Intergenic
980820165 4:138005166-138005188 GAAAAACAGCAGCACATAAAAGG + Intergenic
980855893 4:138439135-138439157 TAATAACAATACAACATCATGGG + Intergenic
980959795 4:139463735-139463757 TAAAAACTGTTGACCATAAAAGG - Intronic
981296355 4:143136889-143136911 TACTGGCAGTAGAAAATAAAAGG - Intergenic
981960692 4:150535040-150535062 TAAAAACATTAAAATATAAAAGG - Intronic
982831480 4:160066566-160066588 AAATAACAGAAGAAAAGAAATGG - Intergenic
982950609 4:161690619-161690641 TAATAACATTGGATCATTAAAGG + Intronic
984078279 4:175211019-175211041 TTAAAACAGTAGAAGTTAAATGG + Intergenic
984213424 4:176878370-176878392 TACTATCAGGAGAACATCAAGGG - Intergenic
984295501 4:177849078-177849100 TAATAACAAAAGAAAATCAAAGG - Intronic
984833745 4:184000033-184000055 TCAACACAGTAGAACATAGAAGG - Intronic
984962040 4:185107215-185107237 TAATACTAGTAGAAAATAAAAGG + Intergenic
985083483 4:186290281-186290303 AAATGACAGTAGAACATAACGGG + Intergenic
986147019 5:5087840-5087862 TAATCACAATAGAACAGAACAGG - Intergenic
986953246 5:13117366-13117388 GAAAAACAGTGGAACATATATGG + Intergenic
987006852 5:13719352-13719374 TAATCAAAGTTAAACATAAAAGG + Intronic
987265107 5:16245307-16245329 TTCTGAGAGTAGAACATAAAAGG + Intergenic
987439489 5:17939087-17939109 TAATAAGACAAGAACATCAAAGG + Intergenic
987925216 5:24331993-24332015 AAAGAACAGTAGAAGGTAAAAGG + Intergenic
988113082 5:26848623-26848645 TAACAAATGTAGAACATAAATGG + Intergenic
988161787 5:27527191-27527213 TAATAACAATTGAACTTACAGGG - Intergenic
988177593 5:27746436-27746458 CAACAACAGTAAAAAATAAAAGG + Intergenic
989219585 5:38941965-38941987 TAATGACAGTGGAACAATAATGG - Exonic
989776642 5:45216606-45216628 AAATAAGAAAAGAACATAAAAGG + Intergenic
990527611 5:56643315-56643337 TAATAATAATAAAACAAAAAAGG + Intergenic
991196936 5:63945762-63945784 TAATAACTCAAGAACACAAAGGG - Intergenic
992327316 5:75673602-75673624 TAACAACAGTTGAAAATAGACGG - Intergenic
992332862 5:75735461-75735483 TAAAAACAGTTTAACACAAAAGG + Intergenic
992504144 5:77368806-77368828 TAATAAGAGTAGAATAGAACAGG - Intronic
992925531 5:81581519-81581541 TAAAAACAGTAGAGAAAAAATGG + Intronic
993839588 5:92861209-92861231 TAAGAAAAGTAAAACAGAAAAGG + Intergenic
993932606 5:93959341-93959363 TAATAATAGTACCACCTAAATGG - Intronic
994913183 5:105939856-105939878 TAATAACAGTAAGACAAAAATGG + Intergenic
995244049 5:109917459-109917481 TAATCACGGTGGAAGATAAAAGG - Intergenic
995863805 5:116669324-116669346 AAATAACAATAGAACTTATAAGG - Intergenic
996028343 5:118676754-118676776 AAGTAACATTAGAAAATAAATGG - Intergenic
996206035 5:120736835-120736857 TATTTACAATAGAACACAAAAGG - Intergenic
996328687 5:122306281-122306303 AAAAAACAGTAGAATACAAAGGG + Intergenic
996645268 5:125807109-125807131 TAATAAAAGAACAAAATAAAAGG - Intergenic
997684942 5:135782050-135782072 TAAAAACAGTATCACAGAAAAGG - Intergenic
998709150 5:144801969-144801991 TTATACTAGTAAAACATAAAGGG + Intergenic
998719618 5:144929550-144929572 TAAAAATGGTAGAACACAAAAGG + Intergenic
1000526154 5:162360531-162360553 TAATTACAGTTGAATATGAATGG + Intergenic
1000952606 5:167502724-167502746 TAAAAACAGTAGATCCCAAAGGG - Intronic
1003063998 6:2886838-2886860 TAATAAAAGTAGTATAGAAAAGG + Intergenic
1003305464 6:4922944-4922966 TAAAAATAGTAAAAAATAAAAGG - Intronic
1004033987 6:11903683-11903705 TATTAACAGTAAAATTTAAAAGG + Intergenic
1004990292 6:21129906-21129928 TAAAAAAAGTAGAAAAAAAAGGG - Intronic
1005123414 6:22417589-22417611 AAATAACAGTTGAGTATAAATGG + Intergenic
1005240186 6:23816482-23816504 TAATAATAATAAAAAATAAAAGG - Intergenic
1005709353 6:28488876-28488898 TAACAGCAGTAGAACACAACTGG - Intergenic
1007007989 6:38385488-38385510 TAATATCAAAAGTACATAAAGGG - Intronic
1008683401 6:53898423-53898445 AAATATCTGTAGGACATAAAGGG + Intronic
1009737512 6:67696385-67696407 TATTAGTAGAAGAACATAAATGG + Intergenic
1010671654 6:78693889-78693911 TAATAACAGTAGATCACAGTGGG - Intergenic
1011369950 6:86625718-86625740 TAAGACCAGTAGAACCTGAATGG - Intergenic
1012008224 6:93744061-93744083 TAATACCAGTAAAACATAGATGG + Intergenic
1012211915 6:96530060-96530082 AATAACCAGTAGAACATAAAGGG - Intronic
1012212536 6:96539403-96539425 TATTAACAGTTTAAAATAAATGG - Intronic
1012764025 6:103341355-103341377 TAAAAACAGTAACAAATAAAGGG - Intergenic
1013240117 6:108237462-108237484 TAATAAGTGTACAACATAAAAGG + Intronic
1013548662 6:111185671-111185693 GCATAACAGAAGAACAAAAATGG + Intronic
1014341859 6:120219507-120219529 TAATAACAGCAGAAGACACATGG - Intergenic
1014420799 6:121243289-121243311 TCAGAACAGTAGAAAGTAAAAGG + Intronic
1014833521 6:126130563-126130585 AAAAAACAGTAAAACATACAAGG - Intergenic
1015352869 6:132243613-132243635 AAATAACAGTAAAACAAAATAGG + Intergenic
1015512309 6:134050261-134050283 TTACAAAAGTAGAAAATAAAAGG + Intronic
1016209225 6:141507696-141507718 TAATACCATTAGGACACAAAAGG - Intergenic
1016305735 6:142681660-142681682 GAATAATAGTAGAACATAGAGGG + Intergenic
1016650999 6:146460452-146460474 TAATAACATTTGAACAAAAATGG - Intergenic
1017400898 6:154060729-154060751 TAATAACAGGAGAACAATAGGGG + Intronic
1019771691 7:2887337-2887359 TAACAACAATAGAATATGAACGG + Intergenic
1020348321 7:7188769-7188791 TAACAACTGTATAAGATAAAAGG - Intronic
1020664855 7:11027277-11027299 TAATAACAGTAGAACATAAATGG - Intronic
1021534515 7:21688365-21688387 TAATAACAATAAAACATAATAGG - Intronic
1021840220 7:24716311-24716333 TAATATGAGTGGAGCATAAAGGG - Intronic
1022123891 7:27337364-27337386 TAAAAACACTTAAACATAAAAGG - Intergenic
1022145269 7:27531578-27531600 TAATAATAGGATAACATAGAAGG - Intronic
1022755863 7:33288608-33288630 CAAAAACATTTGAACATAAAAGG - Intronic
1023068411 7:36402860-36402882 AAATAACAGAAGTATATAAAGGG - Intronic
1023387942 7:39679013-39679035 TAAAAACATTAAAACAAAAAAGG - Intronic
1024431492 7:49293317-49293339 TAATAAGAGTAGAATAATAAGGG + Intergenic
1024572932 7:50739593-50739615 TAAATACAGTAGAACAGAAAAGG - Intronic
1025062787 7:55825565-55825587 TAATAATAGAAGAAAATCAAGGG + Intronic
1026425343 7:70286308-70286330 GAGTATCAGTAAAACATAAATGG + Intronic
1026495427 7:70897644-70897666 TAATAACAATAATAAATAAAAGG - Intergenic
1026615773 7:71902404-71902426 AAATAACAGTAAAAAATAACAGG + Intronic
1028370654 7:90087991-90088013 TAATAACATTTGGATATAAAGGG - Intergenic
1029888628 7:103902222-103902244 TAATAAGAGAAGAACTTAACTGG - Intronic
1030132654 7:106216056-106216078 TAATAATAGTAAAAAAAAAAAGG + Intergenic
1031102098 7:117493770-117493792 TAATAACAGTGGAAGAAAAAAGG + Intronic
1031113015 7:117634330-117634352 TAATATCAATAAAACAAAAAAGG - Intronic
1032301865 7:130694992-130695014 TAAAAACAATAAAACATAATAGG - Intergenic
1032499591 7:132390576-132390598 TAATAACAATAAAAAAGAAAAGG + Intronic
1032887251 7:136154024-136154046 CAATAACAGTAGAAACAAAAAGG - Intergenic
1033032031 7:137836570-137836592 TAATCACAGTGGAACTTGAAGGG - Intronic
1034195480 7:149243497-149243519 TAGAAACAGTTGAATATAAAAGG + Intronic
1036148205 8:6274478-6274500 TGCTCACAGTAGAACACAAATGG - Intergenic
1036221869 8:6928207-6928229 CTAGAACAGTAGAACATCAAAGG + Intergenic
1036741755 8:11368965-11368987 TAAGCACAGGAGAAAATAAAAGG - Intergenic
1037026634 8:14046237-14046259 AAATTACAGTAGAACGTAGAAGG + Intergenic
1037027117 8:14052586-14052608 AAATAACAGCAAAACAGAAAGGG - Intergenic
1037724496 8:21472273-21472295 GAATATAAGTAGAAAATAAAGGG - Intergenic
1038203948 8:25446701-25446723 TAATAAAAGGACAACATAATAGG - Intronic
1038398312 8:27263094-27263116 TAAAAACTATAGAACATCAATGG + Intergenic
1038831794 8:31070373-31070395 TAAAAAGATTAGAACATAAAAGG + Intronic
1040669232 8:49667678-49667700 TTATAAAAGTAGAAAATAATTGG - Intergenic
1041657855 8:60371750-60371772 TAATCACACTAGAAAATAGATGG + Intergenic
1042519874 8:69700167-69700189 TTTTAAAAGTAGAACAGAAAAGG + Intronic
1043309228 8:78837537-78837559 TAATAATAATAGAATAGAAATGG - Intergenic
1044262757 8:90146970-90146992 TAATGAAAGGAGAACAAAAAAGG + Intergenic
1045790141 8:105974296-105974318 TAATAGCAGAAGAAAATTAATGG - Intergenic
1047140065 8:122128291-122128313 TATAAACAGTGGACCATAAATGG - Intergenic
1047594807 8:126367719-126367741 TACTAACAAGAGAACATCAAAGG + Intergenic
1047885218 8:129242895-129242917 TAATAATAGCAGTACATCAAAGG + Intergenic
1048114162 8:131502199-131502221 TAATAAAAGAAGAAAATACATGG - Intergenic
1050980717 9:12010556-12010578 TGATAACTGTAGAACAGAACAGG + Intergenic
1052108480 9:24549263-24549285 TAATGACAATGGAATATAAATGG - Intergenic
1052527208 9:29633349-29633371 TATTAACAGTAGTACTTATAAGG - Intergenic
1052726577 9:32235201-32235223 TAATAATTCTAGAAAATAAAAGG + Intergenic
1053210714 9:36225264-36225286 TAATAACAAAATAATATAAATGG - Intronic
1053620701 9:39811633-39811655 AAATAAAATTAGAACAAAAAAGG - Intergenic
1053626011 9:39872298-39872320 AAATAAAATTAGAACAAAAAAGG + Intergenic
1053878866 9:42570917-42570939 AAATAAAATTAGAACAAAAAAGG - Intergenic
1053893801 9:42723442-42723464 AAATAAAATTAGAACAAAAAAGG + Intergenic
1054217877 9:62378403-62378425 AAATAAAATTAGAACAAAAAAGG - Intergenic
1054232825 9:62530778-62530800 AAATAAAATTAGAACAAAAAAGG + Intergenic
1054263465 9:62895807-62895829 AAATAAAATTAGAACAAAAAAGG + Intergenic
1055469647 9:76598542-76598564 TACTAACAGTAGATAATAACAGG - Intergenic
1055735025 9:79318212-79318234 TAATACAAGTAGATTATAAAGGG + Intergenic
1056536245 9:87530170-87530192 TAATAACAATAGAACATAATGGG - Intronic
1057066535 9:92057607-92057629 TATGAACAGTAGTTCATAAAAGG - Intronic
1058242861 9:102588018-102588040 TAATAACAGTAAAAGGTGAAAGG + Intergenic
1058641050 9:107085844-107085866 TAAACAAAGTATAACATAAAAGG - Intergenic
1058733665 9:107874802-107874824 TAATAACAATGAAACATGAACGG - Intergenic
1059805325 9:117793462-117793484 CAATATCAGTAGGATATAAAAGG - Intergenic
1203491362 Un_GL000224v1:108491-108513 TACTAACAGGAGAACAGCAAGGG + Intergenic
1203503986 Un_KI270741v1:50361-50383 TACTAACAGGAGAACAGCAAGGG + Intergenic
1185919560 X:4075398-4075420 TAATACCACTAGAACTTAATAGG - Intergenic
1188626085 X:32286461-32286483 TAATATCGCTAGAACATAATTGG + Intronic
1188641254 X:32508486-32508508 TGATAACAGCAGAGCAAAAAGGG - Intronic
1190684359 X:52857608-52857630 TAATATCAGTACAAAAAAAAAGG + Intergenic
1192540852 X:71971305-71971327 TAATAACAATAGCACAAAAATGG - Intergenic
1192581550 X:72286748-72286770 TTATAATAGTAGAAAAAAAAGGG - Intronic
1192937117 X:75871630-75871652 CAATAATAGTGGAAGATAAAGGG - Intergenic
1193509390 X:82381473-82381495 AAATAACACAAGAAAATAAATGG - Intergenic
1194259787 X:91679425-91679447 TAATAACAGTATTAAATACAAGG - Intergenic
1194638944 X:96378890-96378912 TCATAACAGAAAAACAGAAAAGG + Intergenic
1194671912 X:96744009-96744031 AAATAACAGTATAATATAATAGG + Intronic
1194933825 X:99923108-99923130 GAATAACATGAGAACAGAAAAGG - Intergenic
1196020410 X:110985141-110985163 TAAAAACATTAAAATATAAATGG - Intronic
1196093743 X:111776139-111776161 TAATAAAACAAGAACAAAAATGG + Exonic
1198017595 X:132627736-132627758 TAAAATCAGAAGAAAATAAAAGG + Intronic
1198448601 X:136743440-136743462 AAATAAGAGTAGAACAGAACTGG - Intronic
1198558302 X:137819712-137819734 AAATAAAAGTTGAAAATAAAAGG + Intergenic
1200985218 Y:9296405-9296427 TAATATGAGAAGAAAATAAATGG - Intergenic
1201622937 Y:15980379-15980401 TAATAGCACTAAAAGATAAAGGG + Intergenic
1201718977 Y:17076722-17076744 TAACAAAGGAAGAACATAAAGGG - Intergenic
1202125232 Y:21563780-21563802 TAATATGAGAAGAAAATAAATGG + Intergenic
1202153776 Y:21865612-21865634 TAATATGAGAAGAAAATAAATGG - Intergenic
1202575432 Y:26319370-26319392 TAATCACTTTAGAACAAAAATGG + Intergenic