ID: 1020664858

View in Genome Browser
Species Human (GRCh38)
Location 7:11027312-11027334
Sequence TAACTAGGCAGTAGGATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020664854_1020664858 25 Left 1020664854 7:11027264-11027286 CCAGTATATTATACCATTTATGT 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1020664858 7:11027312-11027334 TAACTAGGCAGTAGGATGTCAGG No data
1020664855_1020664858 12 Left 1020664855 7:11027277-11027299 CCATTTATGTTCTACTGTTATTA 0: 1
1: 0
2: 1
3: 46
4: 403
Right 1020664858 7:11027312-11027334 TAACTAGGCAGTAGGATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020664858 Original CRISPR TAACTAGGCAGTAGGATGTC AGG Intronic
No off target data available for this crispr