ID: 1020665816

View in Genome Browser
Species Human (GRCh38)
Location 7:11041577-11041599
Sequence GCCTCCAACAAAAAAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 736
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 686}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020665816_1020665819 18 Left 1020665816 7:11041577-11041599 CCTTCTGTTTTTTTGTTGGAGGC 0: 1
1: 0
2: 2
3: 47
4: 686
Right 1020665819 7:11041618-11041640 CAAATAACTTCCTTGAAGTGTGG No data
1020665816_1020665820 19 Left 1020665816 7:11041577-11041599 CCTTCTGTTTTTTTGTTGGAGGC 0: 1
1: 0
2: 2
3: 47
4: 686
Right 1020665820 7:11041619-11041641 AAATAACTTCCTTGAAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020665816 Original CRISPR GCCTCCAACAAAAAAACAGA AGG (reversed) Intronic
900258834 1:1712126-1712148 GCCTCCAAAAAAAAAAAAAAAGG + Intronic
900531946 1:3158774-3158796 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
901774655 1:11552024-11552046 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
902856128 1:19207070-19207092 GACTGCAACAGAAAAACAGATGG + Intronic
903191878 1:21661247-21661269 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
903233272 1:21934596-21934618 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
903611589 1:24618707-24618729 GTCTTAAAAAAAAAAACAGATGG + Intergenic
903871381 1:26437471-26437493 GTCTCAAAAAAAAAAAAAGATGG - Intronic
904164594 1:28545717-28545739 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
904501904 1:30917664-30917686 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
905192737 1:36248271-36248293 GCCACCAACAAATAAAGATATGG - Intronic
905740327 1:40364739-40364761 GTCTCCAAAAAAAAAAAAAATGG + Intronic
906131967 1:43465633-43465655 GAGTCCAAACAAAAAACAGATGG + Intergenic
906161948 1:43656727-43656749 ACCTCAAAAAAAAAAAAAGATGG - Intronic
907036522 1:51221061-51221083 GCTTCCAAAAAAAAAAAAAAAGG - Intergenic
907174045 1:52501001-52501023 AACTCCTAGAAAAAAACAGAAGG + Intronic
908914266 1:69107862-69107884 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
909314379 1:74197668-74197690 GCCTACTAAGAAAAAACAGAGGG + Intronic
909642886 1:77887221-77887243 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
909984414 1:82143020-82143042 CCTTCCAAAAAAAAAAAAGAAGG - Intergenic
910016170 1:82527150-82527172 GCCTACATCAAAAAGACTGAAGG - Intergenic
911635895 1:100236088-100236110 GTCTCCAAAAAAAAAAAGGAGGG - Intronic
911968045 1:104392703-104392725 GGCTCCAATAAAATAACAGCTGG + Intergenic
912817345 1:112839858-112839880 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
912984327 1:114411561-114411583 GCATCCCACCTAAAAACAGAAGG + Intronic
913436434 1:118851967-118851989 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
914192991 1:145427054-145427076 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
914710174 1:150205948-150205970 GTCTCAAAAAAAAAAAGAGAAGG + Intergenic
914864757 1:151417360-151417382 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
915205468 1:154267506-154267528 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
915711201 1:157900011-157900033 GCTTTCAACAAAAAATCACAAGG + Intergenic
915999702 1:160603317-160603339 GCCTACATCAAAAAATCTGAAGG - Intergenic
916297593 1:163236956-163236978 GTCTCAAAAAAAAAAAAAGATGG + Intronic
916334861 1:163659345-163659367 ACCACAAACAAAAAAACTGAGGG - Intergenic
916341464 1:163740770-163740792 GCCTCCACCAAAAAAACTACTGG - Intergenic
916388734 1:164306749-164306771 TCCTCCAACTATAAAATAGAGGG - Intergenic
916500204 1:165380583-165380605 GCCTCCAGCAAAAGACCTGATGG - Intergenic
917078160 1:171227657-171227679 GCCTCCAACAAATATACACCAGG + Intergenic
918252169 1:182712646-182712668 GGCTACAACAGAAGAACAGAAGG - Intergenic
918310875 1:183284326-183284348 CCCTCAAACACAGAAACAGAAGG - Intronic
918360136 1:183749230-183749252 GACTCCCACAAAATAACAGTGGG - Intronic
918457212 1:184733822-184733844 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
919068067 1:192718076-192718098 GCCTCCAATACAATAACAGCTGG + Intergenic
919560682 1:199114850-199114872 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
919954264 1:202396922-202396944 GGCTCCAAAATAAAGACAGAAGG - Intronic
920001368 1:202801974-202801996 GCCTCAAAAAAAAAAAAAGATGG - Intronic
920063687 1:203248611-203248633 GCCACCAAAAAGATAACAGAAGG - Intronic
920202561 1:204268577-204268599 ACCTCCAAAAAAAAAAAAAAAGG - Intronic
921376742 1:214481982-214482004 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
921391060 1:214614104-214614126 GACTCAAAAAAAAAAAAAGAAGG - Intronic
921401135 1:214725290-214725312 GACTCCCACAAAAAAATAGTGGG - Intergenic
923038462 1:230301862-230301884 GCCTCTACCAAAAATACAAAAGG - Intergenic
923044307 1:230344280-230344302 GTCTCCAAAAAAAAAAAAGAAGG + Intronic
923398891 1:233596008-233596030 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
923742738 1:236670687-236670709 GCCTCAAAAAAAAAAAAAGAAGG + Intergenic
923928157 1:238659557-238659579 GCCTCAAAAAAAAAAAAAGATGG - Intergenic
924309524 1:242725602-242725624 GTCTCAAACAAACAAACAAACGG + Intergenic
1062785380 10:260442-260464 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1063446673 10:6122495-6122517 GTCTCCAAAAAAAAAAAAGAGGG - Intergenic
1063714294 10:8512735-8512757 GTCTCCAAAAAAAAAGCAAAGGG - Intergenic
1063979329 10:11441132-11441154 GCCCACAAAAAAAAAACAGGAGG - Intergenic
1064004452 10:11688894-11688916 CCCTCCAAGACAGAAACAGAAGG - Intergenic
1064404065 10:15045550-15045572 GGCTCTAAGAAACAAACAGATGG + Intronic
1064416039 10:15151058-15151080 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1064776336 10:18781915-18781937 GTCTCCAACAAAAAGATAAATGG - Intergenic
1064865936 10:19879892-19879914 TCCTCCAATAACATAACAGAAGG - Intronic
1066178509 10:32936525-32936547 TCCCCCAACAAAAAAAAAGAGGG + Intronic
1066473738 10:35724546-35724568 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
1068319797 10:55397589-55397611 GACTCCATCAAAAAAATAAAAGG - Intronic
1068644509 10:59450797-59450819 GCGGCCATTAAAAAAACAGAGGG - Intergenic
1069008445 10:63344729-63344751 GTCTCCAAAAAAAAAATAGACGG + Intronic
1069452908 10:68531478-68531500 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1070038129 10:72748048-72748070 GTCTCAAAAAAAAAAAAAGATGG - Intronic
1070268623 10:74929920-74929942 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1070935551 10:80291982-80292004 CCCCCCAATAAAAAAACATAAGG - Intergenic
1072158254 10:92743390-92743412 ACCCCCACCAAAAAAAAAGATGG - Intergenic
1072330373 10:94343079-94343101 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1072340210 10:94440170-94440192 GCCTCCAAAAAAAAAAAGAAAGG - Intronic
1072832715 10:98676030-98676052 GCCTCAAAGAAAAAAAAAAAAGG + Intronic
1073385038 10:103119365-103119387 GTCTCCAAAAAAAAGTCAGAGGG + Intronic
1073558545 10:104477675-104477697 AACTCAAATAAAAAAACAGAAGG - Intergenic
1073966137 10:108992711-108992733 GCCTACAATAAAAAATCAAATGG + Intergenic
1075090250 10:119440382-119440404 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1075152328 10:119945192-119945214 GCCTCAAACATAAAAATAAAGGG + Intergenic
1075216044 10:120536414-120536436 GACTCCAACAACACACCAGAGGG + Intronic
1075681743 10:124338312-124338334 CCCTCCAAGAAAAAAAGGGAAGG - Intergenic
1075751488 10:124775918-124775940 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1076884033 10:133253235-133253257 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1076891535 10:133286789-133286811 GGCTCCAACAAGAAATCAGAGGG + Intronic
1078603759 11:12756950-12756972 CCCTCCAACAAAAAGACTGGGGG - Intronic
1078723797 11:13909458-13909480 GCCTCCTACAAAATAGCAGCTGG - Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG + Intergenic
1079583403 11:22094436-22094458 GCCTCAAAAACAAAAAAAGAAGG + Intergenic
1080080605 11:28214043-28214065 GTCTCCAATAAAAAAAAAGATGG - Intronic
1080171443 11:29307848-29307870 GCCTCCATACAAAAACCAGAAGG - Intergenic
1080279524 11:30540594-30540616 CCCTACAACAGAAAAAGAGATGG - Intronic
1080671719 11:34385654-34385676 GTCTCCAAAAAAAAAAAAAATGG - Intergenic
1080827188 11:35858378-35858400 GCCTAGAACCAAAAGACAGAGGG - Intergenic
1081832229 11:46122750-46122772 CCCTCCAAAAAAAAAAAAAAAGG - Intergenic
1082018759 11:47513460-47513482 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
1082038019 11:47661755-47661777 GTCTCCAAAAAAAAAAAAGGTGG - Intronic
1082698544 11:56400879-56400901 GCCCCCACCAAAAAAAATGAGGG - Intergenic
1082820346 11:57540711-57540733 GTCTCAAAAAAAAAAAAAGAGGG - Intergenic
1084074277 11:66760993-66761015 TCCTCCAAAAAAAAAAAAAAAGG - Intronic
1085138197 11:74113782-74113804 GCCTCCAGTAAAATTACAGATGG - Exonic
1085619538 11:78027364-78027386 GCCTCAAAAAAAAAAAAATAGGG - Intronic
1086479359 11:87217780-87217802 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1086593499 11:88543632-88543654 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1086645768 11:89218127-89218149 GCCTATAACATAAAAACATAAGG + Intronic
1088075944 11:105848723-105848745 GACACCAACAAGAAAAAAGATGG + Intronic
1089729068 11:120509412-120509434 GCCTTGAATGAAAAAACAGAAGG - Intergenic
1092199677 12:6572558-6572580 GACTCCAGAAAAAAAAGAGATGG - Intronic
1093455768 12:19363492-19363514 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1093456585 12:19371004-19371026 GCCTCGAAAAAAAAAAAAAAAGG - Intronic
1093559870 12:20525127-20525149 GTCTCCAACAAAAAAGAAGATGG + Intronic
1093618832 12:21263328-21263350 GCTTCCAACAAAAAGTCACAAGG - Intergenic
1094419424 12:30255178-30255200 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1095335276 12:41016853-41016875 GCCTTCAACAACAAAGGAGATGG + Exonic
1095644052 12:44521525-44521547 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1096172863 12:49487480-49487502 GCCTCCAAAAAATAAAAAAACGG + Intronic
1096707130 12:53429387-53429409 GACTCAAAAAAAAAAAAAGAGGG + Intronic
1096862530 12:54540189-54540211 GCCTCGGACAAGAATACAGATGG - Intronic
1097228899 12:57496772-57496794 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1097284545 12:57867382-57867404 CCCTCCCACAACCAAACAGAAGG - Intergenic
1097427220 12:59461252-59461274 GCCACCAACATAAAAACTGCAGG + Intergenic
1097667789 12:62500612-62500634 GCCTCCAAAACAAAAAAAAATGG - Intronic
1098346903 12:69514827-69514849 GTCTCAAAAAAAAAAAAAGATGG + Intronic
1098431834 12:70428019-70428041 GCCTCCAAAAGAAAAAAAAATGG - Intronic
1098825883 12:75296759-75296781 ACCACCACCAAAAAAAAAGAGGG + Intronic
1098881617 12:75923081-75923103 GCCTGCAACAGAAACAGAGAAGG - Intergenic
1099248377 12:80221267-80221289 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1100199152 12:92279774-92279796 GCTTCCAGGAAATAAACAGATGG - Intergenic
1100448474 12:94682822-94682844 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1100748279 12:97669614-97669636 GACTCCATCAAAAAAAAAAAAGG - Intergenic
1100757919 12:97772884-97772906 ACCTCATGCAAAAAAACAGAGGG - Intergenic
1101411112 12:104469321-104469343 GCATTCAGCAAAAAAACACAAGG - Intronic
1101565812 12:105904073-105904095 GACCACAACAAACAAACAGAAGG - Intergenic
1101858055 12:108460626-108460648 GTCTCCAAAAAAAAAAAAGTCGG + Intergenic
1102074931 12:110052194-110052216 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1102092260 12:110201397-110201419 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1102163012 12:110784719-110784741 GTCTCCAAAAAAAAAAAAAATGG - Intergenic
1102314671 12:111877681-111877703 GTCTCCAACAAAAAAAAGAAAGG - Intronic
1103530511 12:121597953-121597975 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
1104261152 12:127183357-127183379 CCCCCCAAAAAAAAAAGAGATGG - Intergenic
1105364005 13:19747750-19747772 GATTCCTACAAAAAAGCAGAAGG + Intronic
1105490202 13:20880953-20880975 GCCTCCAAAAAAAAAAAAAAAGG + Intronic
1105862978 13:24433266-24433288 TAATCCAACAAAGAAACAGATGG - Intronic
1107086759 13:36433541-36433563 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1107521169 13:41183289-41183311 ATCTCCAAAAAAAAAAAAGAAGG - Intergenic
1107660906 13:42638192-42638214 GTCTCAAAAAAAAAAAGAGAGGG + Intergenic
1107703466 13:43073954-43073976 GCCTCAAAAAAAAAAGAAGAAGG - Intronic
1107716890 13:43209143-43209165 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1108603348 13:52013187-52013209 CCCTCCACTAATAAAACAGAAGG + Intronic
1108642929 13:52399478-52399500 ACCCCAAACAAAAAAACACATGG - Intronic
1110260975 13:73484934-73484956 GCCTGCAAAAAAAAAAAAGTGGG + Intergenic
1111235752 13:85405694-85405716 GCCTCACGCAAAAAGACAGAGGG - Intergenic
1113088222 13:106590539-106590561 GTCTCAAACAAAAAAAGAAATGG - Intergenic
1113352740 13:109545252-109545274 CCCTCCAAAAAAAAAAAAAAAGG + Intergenic
1113444876 13:110357451-110357473 CCCTGCAACAATAAAACACAAGG - Exonic
1114081579 14:19205334-19205356 GACTCCATCAAAAAAGAAGAAGG - Intergenic
1114849227 14:26362806-26362828 GCTTCCAATAAATAGACAGATGG - Intergenic
1115256572 14:31409050-31409072 GTCTCAAAAAAAAAAAAAGATGG + Intronic
1115530985 14:34326984-34327006 GCCCCCATCAGCAAAACAGAAGG + Intronic
1115582730 14:34777639-34777661 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1115638096 14:35310190-35310212 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1116985991 14:51221021-51221043 CCCTCCAAGAAACAAATAGAAGG - Intergenic
1117385193 14:55204809-55204831 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
1117696576 14:58370615-58370637 CCCCCCAACAACAAAAAAGACGG - Intronic
1118082037 14:62372059-62372081 GCCTCACACAAAAAGACAGAGGG - Intergenic
1118196870 14:63635007-63635029 GTCTCCAAAAAAAAAAAAAATGG + Intronic
1118273417 14:64364293-64364315 GTCTCAAATAAAAAAAAAGAAGG - Intergenic
1118281000 14:64428554-64428576 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1118283207 14:64447955-64447977 GCCTTCAAGAAAAAAAGAGCTGG - Intronic
1118496405 14:66312067-66312089 GCCTTCAACTATAGAACAGATGG + Intergenic
1118585407 14:67347912-67347934 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1118638853 14:67773529-67773551 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1118841243 14:69514625-69514647 GCATTCAACAAAAAATCACAAGG - Intronic
1118877988 14:69800798-69800820 GACTCCCACACAATAACAGAGGG + Intergenic
1119232500 14:72991907-72991929 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
1119244255 14:73090057-73090079 GACTGCATCAAAAAAAAAGAGGG - Intronic
1119370649 14:74138765-74138787 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
1119655072 14:76411444-76411466 TCTTCCAAAAAAAAAACAGGAGG + Intronic
1120099246 14:80425113-80425135 GTCTCAAACAAACAAACAAAAGG + Intergenic
1120909672 14:89654705-89654727 GTCTCCAAAAAAAAAAAAGGGGG + Intergenic
1121260779 14:92564644-92564666 GCCCCCACCAAAAAAACAGCGGG - Intronic
1121431649 14:93892210-93892232 GCCTCCACCAAAAGAGCAGAAGG - Intergenic
1122610035 14:102976031-102976053 GCCTCGATCAGAAAAACAGCTGG + Exonic
1122616715 14:103023012-103023034 GCCTCAAAAAAAAAAAGAAAAGG - Intronic
1122667833 14:103345894-103345916 GCCTCCACCAAAAACAGGGAGGG - Intergenic
1122980528 14:105190411-105190433 CCCACCAAAAAAAAAAAAGATGG + Intergenic
1123894546 15:24815596-24815618 GCCTCTAATAAAAATACAGCTGG - Intergenic
1124463009 15:29909873-29909895 GCCTCCAACAACTTAACTGATGG - Intronic
1124681946 15:31739593-31739615 GTCTCCAAAAAAAAAAGATATGG - Intronic
1125705515 15:41732149-41732171 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1126179384 15:45769798-45769820 GTCTCAAAAAAAAAAAAAGAAGG - Intergenic
1126650899 15:50920411-50920433 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1126653365 15:50949408-50949430 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
1126805207 15:52340948-52340970 GTCTCAAAAAAAAAAAAAGAGGG + Intronic
1127140894 15:55975624-55975646 GACACCAAAAAAAAAACAAAAGG + Intronic
1128978890 15:72172417-72172439 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1129014291 15:72451869-72451891 GACTCCATCAAAAAAATAAAAGG + Intergenic
1129932404 15:79422544-79422566 GTCTCCAAAAAAAAAAAAAAGGG + Intronic
1130059919 15:80562075-80562097 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1130593961 15:85236037-85236059 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1131388403 15:92027085-92027107 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1131715166 15:95101780-95101802 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
1131751262 15:95510467-95510489 CCCTCCAACAACATAACTGATGG + Intergenic
1132202931 15:99967591-99967613 GTCTCAAAAAAAAAAAAAGAGGG - Intergenic
1132233778 15:100203893-100203915 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1132418030 15:101638294-101638316 GTCTCCAAAAAAAAAAAAGGTGG - Intronic
1132716583 16:1293106-1293128 GTCTCAAAAAAAAAAAAAGATGG - Intergenic
1132818554 16:1848543-1848565 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1132982624 16:2746306-2746328 GTCTCCAAAAAAAAAAAAAATGG - Intergenic
1133632753 16:7637267-7637289 TCCTCAAAAAAAAAAAAAGAAGG + Intronic
1133798427 16:9065316-9065338 GCCTCTACCAAAAAAAAAAAAGG + Intergenic
1134155046 16:11836145-11836167 TAATCCAACAAAGAAACAGATGG - Exonic
1134392263 16:13830844-13830866 GTCTCAAAAAAAAAAAAAGAAGG - Intergenic
1134407884 16:13978192-13978214 CCCTCCAACACACAAACAAATGG - Intergenic
1134622679 16:15701232-15701254 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1134780112 16:16887849-16887871 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1134873048 16:17668960-17668982 TCCTCAAGCCAAAAAACAGATGG + Intergenic
1135318093 16:21468303-21468325 GTCTCCAAAAAAAAAAGAGTGGG + Intergenic
1135370986 16:21900098-21900120 GTCTCCAAAAAAAAAAGAGTTGG + Intergenic
1135381662 16:22001016-22001038 GCCTCCCACAAAAACAAAAAAGG - Exonic
1135690529 16:24533656-24533678 GCCTCTAAAAAAAAAAAAAAAGG + Intergenic
1135964248 16:27022765-27022787 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
1136362298 16:29788694-29788716 GTCTCAAAAAAAAAAAGAGATGG + Intergenic
1136442989 16:30289770-30289792 GTCTCCAAAAAAAAAAGAGTGGG + Intergenic
1136493159 16:30624272-30624294 GCCTCCAACACACAAACATGGGG + Intergenic
1137734714 16:50715416-50715438 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
1137887940 16:52126671-52126693 ATCTCCAAAAAAAAAAAAGAAGG - Intergenic
1138244801 16:55459631-55459653 TCCCCCTACAAAAAAATAGAGGG + Intronic
1138523509 16:57587523-57587545 GTCTCAAAAAAAGAAACAGAGGG - Intronic
1139134685 16:64187575-64187597 GTCTCAAACAAAAAAATAGTTGG + Intergenic
1139542944 16:67632069-67632091 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1139543479 16:67636367-67636389 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1139734719 16:68977698-68977720 GTCTCAAAAAAAAAAAGAGATGG + Intronic
1139762722 16:69199591-69199613 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
1139802186 16:69531989-69532011 GCCTCAAAAAAAAAAAAAAAGGG - Intergenic
1139837467 16:69850786-69850808 AACACCAACAAAAAAGCAGATGG - Intronic
1140868945 16:79089332-79089354 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1141631871 16:85292141-85292163 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1142334258 16:89477193-89477215 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1142795595 17:2304252-2304274 GACTCCAACTAAAAAAAAAAGGG - Intronic
1142817717 17:2440250-2440272 GTCTCAAAAAAAAAAAAAGATGG - Intronic
1143266967 17:5645496-5645518 GTCTCAAAAAAAAAAAAAGAGGG - Intergenic
1143975149 17:10824024-10824046 TCCTCCAACCCAAAAACAAAAGG - Exonic
1144095629 17:11898126-11898148 GCCTCAAAAAAAAAAAGAAAAGG - Intronic
1145075776 17:19853571-19853593 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1145189078 17:20822731-20822753 GTCTCAAACAAAAAAAAAAAAGG - Intergenic
1145268253 17:21390767-21390789 ACCTCCAAGAAAAAAACATTGGG - Intronic
1145282761 17:21479746-21479768 CCCTGAAACAAAAAAACAAAAGG + Intergenic
1145394716 17:22486052-22486074 CCCTGAAACAAAAAAACAAAAGG - Intergenic
1145842227 17:28005086-28005108 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1147010366 17:37441667-37441689 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1147343470 17:39770335-39770357 TCTTCCAACAAAAATACACACGG + Intronic
1147592662 17:41694824-41694846 GTCTCCAAAAAAAAAAAAGAAGG + Intergenic
1147645718 17:42032712-42032734 GTCTCAAAAAAAAAAAAAGATGG - Intronic
1147781137 17:42942999-42943021 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
1148188636 17:45663065-45663087 CCCTCCAAAAAAAAATCATAAGG - Intergenic
1148898409 17:50854887-50854909 CCCTCCAAAAAAAAAAAAAAAGG + Intergenic
1149202832 17:54207710-54207732 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
1149653143 17:58290887-58290909 GTCTCAAAAAAAAAAAAAGACGG - Intergenic
1149808088 17:59638331-59638353 GTCTCTTAAAAAAAAACAGAAGG + Intronic
1149825484 17:59824246-59824268 GTCTCCAAAAAAAAAAAAAAGGG + Intronic
1149843599 17:59988326-59988348 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1150027060 17:61687857-61687879 GCCTCCCAGAAAAAGACATAAGG - Intronic
1150307860 17:64101405-64101427 GTCTCCAAAAAAAAAAGAAAGGG + Intronic
1151218568 17:72594072-72594094 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1151538792 17:74753718-74753740 GTCTCTACCAAAAAAACAGGGGG + Intronic
1151847558 17:76667933-76667955 GCCTACAAAAAAAAAAAAAAAGG + Intergenic
1152096848 17:78277679-78277701 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
1152916658 17:83040458-83040480 TCATTCAACATAAAAACAGAGGG + Intronic
1152998811 18:433959-433981 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
1153004064 18:481700-481722 ACCTCCAAAAAAAAAAGAGAGGG + Intronic
1153521422 18:5957955-5957977 ACCTCAAAAAAAAAAAAAGAAGG + Intronic
1153877198 18:9384646-9384668 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1154939274 18:21094744-21094766 GTCTCAAAAAAAAAAAAAGATGG + Intronic
1155147112 18:23093376-23093398 GCCTACTACAAAAATACAAAAGG - Intergenic
1155886580 18:31216189-31216211 AACTCCTACAAAAAAACAGAGGG + Intergenic
1157215576 18:45780473-45780495 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
1157295899 18:46443186-46443208 GACAACAACAACAAAACAGATGG - Intronic
1157304187 18:46505182-46505204 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1157541103 18:48508021-48508043 GCCTACATCAAAAAGACTGAAGG + Intergenic
1157934828 18:51861337-51861359 GCCTATAACATAAATACAGAGGG - Intergenic
1158190666 18:54824822-54824844 GTCTCCAAGAAAAAAAAAAATGG - Intronic
1161035170 19:2080378-2080400 GCCTCAAAAAAAAAAAGAGGTGG - Intronic
1161765650 19:6206859-6206881 GCCTCAAAAAACAAAACAAATGG + Intergenic
1162208034 19:9070571-9070593 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1162319901 19:9965454-9965476 GCCTAGAAAAAAAAAAAAGAAGG - Intronic
1162437026 19:10667252-10667274 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1162727400 19:12698125-12698147 GTCTCAAACAAAAAAACTGCAGG + Intergenic
1163131284 19:15274868-15274890 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1163616311 19:18330935-18330957 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
1163962460 19:20709892-20709914 TAATCCAACAAAGAAACAGATGG + Intronic
1164668236 19:30056985-30057007 GACTCCAACTAAAAAAAAGTTGG - Intergenic
1165227184 19:34363303-34363325 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1165522922 19:36328643-36328665 GCCTTCAAAAAAAAAAAAAAAGG - Intergenic
1165663830 19:37608577-37608599 CCTTCCAACAAAAAATTAGAAGG - Intronic
1165735142 19:38171107-38171129 ACCATTAACAAAAAAACAGAAGG + Intronic
1165879012 19:39029848-39029870 GACTCCATCAAAAAAAGAAAGGG - Intronic
1165944184 19:39431712-39431734 GTCTCCAAAAAAAAAAAAGGCGG + Intergenic
1166511665 19:43413491-43413513 GACTCCAAAAAAAAAAAAAAAGG + Intronic
1166880853 19:45929203-45929225 GACACCAACGAAAAAAGAGAGGG + Intergenic
1167166782 19:47804058-47804080 CCCTCCAAGAAAAAGAAAGAAGG - Intronic
1167175054 19:47859706-47859728 CCCTCCAAGAAAAAGAAAGAAGG + Intergenic
1167283267 19:48583811-48583833 GTCTCAAACAAACAAACAAAAGG + Intronic
1167451766 19:49574720-49574742 GACTCCTCCCAAAAAACAGAAGG - Intronic
1167887166 19:52509882-52509904 GCCTCAAACAGAAAAAAAAAAGG - Intronic
1167973029 19:53200740-53200762 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1168044650 19:53785883-53785905 GTCTCAAAAAAAAAAAGAGAGGG - Intergenic
1168350523 19:55673318-55673340 GCTTGCAAAAAAAAAAAAGAGGG - Intronic
1168440613 19:56362866-56362888 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
925373831 2:3367460-3367482 GTTTCCAACACAGAAACAGAAGG + Intronic
925453732 2:3995518-3995540 GGCTCCAACAAAAAATTATAAGG - Intergenic
925656592 2:6156379-6156401 GCCTCACACAAAAAGGCAGAGGG + Intergenic
925849538 2:8067500-8067522 GACTCCCTCAAAAAAAAAGAAGG + Intergenic
926140379 2:10364585-10364607 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
927530322 2:23792063-23792085 GTCTCAAAAAAAAAAAAAGATGG - Intronic
927612262 2:24553220-24553242 GCCTCAAAAAAAAAAAAAGAAGG - Intronic
927849841 2:26491968-26491990 GGCTCCATTAAAACAACAGAGGG - Intronic
927888100 2:26730739-26730761 ACCCCCAACATAAACACAGAGGG - Exonic
928055269 2:28046783-28046805 GTTTCCAAAAAAAAAAAAGATGG - Intronic
928145492 2:28771053-28771075 GCCTCAAAAAAAAAAAAAAAGGG - Intronic
928513990 2:32028111-32028133 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
928773516 2:34731091-34731113 GTCTCAAACAAAAAAAAAAAAGG + Intergenic
929430696 2:41883908-41883930 TTCTACAACAAAAAAACAAAGGG + Intergenic
929739386 2:44587647-44587669 GTCTCCACCAAAAAAAAAAAAGG - Intronic
930193059 2:48480179-48480201 ACCTCCAGAAATAAAACAGATGG - Intronic
930514282 2:52386621-52386643 GCCTCCCACAACAAGACAGCTGG + Intergenic
931283205 2:60811381-60811403 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
932147517 2:69336027-69336049 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
933350453 2:81146222-81146244 TCCTCAAAAAAAAAAAAAGAGGG + Intergenic
933815761 2:86067417-86067439 GCCCTCAATAAATAAACAGAAGG + Intronic
933933394 2:87178752-87178774 GTCTCAAAAAAAAAAAAAGAAGG - Intergenic
934059284 2:88279354-88279376 GCCTCAAAAAAAAAAAAAAATGG + Intergenic
934541751 2:95181132-95181154 GCTTCAGACAAAAAATCAGAAGG + Exonic
935522610 2:104126401-104126423 GCCTCTACTAAATAAACAGATGG + Intergenic
935537330 2:104309544-104309566 GCCTCTAAAAAAAAAAAAAAAGG + Intergenic
935756366 2:106279009-106279031 GTCTCAAAAAAAAAAAAAGATGG - Intergenic
935887139 2:107634586-107634608 GCTTTCAACAAAAAATTAGAAGG - Intergenic
935973688 2:108556624-108556646 GCCTCCAACAAAGGAAGGGAGGG - Intronic
936026359 2:109033950-109033972 GACTCCAAAAAAAAAAAAAAAGG + Intergenic
936359720 2:111786693-111786715 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
937765431 2:125655549-125655571 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
937934987 2:127236288-127236310 GCTTCCAACAAAAAATTACAAGG + Intergenic
938019175 2:127892198-127892220 GCCTCCTACCAAAAAAGTGAGGG - Intergenic
938656288 2:133437348-133437370 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
939290981 2:140194452-140194474 GACTACAACATAAGAACAGAAGG + Intergenic
939364862 2:141218767-141218789 ATCTACAATAAAAAAACAGAGGG + Intronic
939686357 2:145205384-145205406 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
940079114 2:149779925-149779947 GACTCCATCAAAGAAAGAGAAGG - Intergenic
940548006 2:155114807-155114829 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
940762991 2:157758584-157758606 GACTCCAACACAATAACAGTTGG + Intronic
940772107 2:157850384-157850406 GTCTCAAAAAAAAAAAAAGAGGG + Intronic
940832497 2:158482823-158482845 GCTTCAAAAAAAAAAAAAGAGGG + Intronic
941610760 2:167659231-167659253 ACCACCAAAAAAAAAACACATGG - Intergenic
942302760 2:174577912-174577934 GTCTCCAAAAAAAAAAAAGGGGG + Intronic
943444996 2:187973726-187973748 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
943474755 2:188340620-188340642 ACCTCACACAAAAAGACAGAGGG - Intronic
943642048 2:190370367-190370389 GCTTCCAACACAAAGAAAGATGG - Intronic
944228238 2:197369498-197369520 GCCACCAAAAAAAGAAAAGAAGG - Intergenic
945341749 2:208664359-208664381 GCCTCCATAGAAGAAACAGATGG + Intronic
946445784 2:219738810-219738832 GACTCCAAGAAAAAAAAAAAAGG + Intergenic
946797044 2:223365777-223365799 GCCTTCCACAAAAAAACAGAAGG - Intergenic
946834422 2:223758630-223758652 GGCTCCATCAAAAAACCGGATGG + Exonic
947316110 2:228860777-228860799 GCCATCAACATAAAAACAGCTGG - Intronic
947560351 2:231144251-231144273 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
947631826 2:231658453-231658475 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
947649502 2:231773582-231773604 GCTTCCAATCAAAAAACAGTTGG - Intronic
948005943 2:234607562-234607584 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
948128287 2:235581303-235581325 GTCTCAAAAAAAAAAAAAGATGG + Intronic
948415580 2:237800726-237800748 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
948503063 2:238408858-238408880 AGCTCCAACAAAACAGCAGAGGG - Intergenic
1168868642 20:1110123-1110145 GGCTCCTACAAAAGAAGAGAAGG - Intergenic
1169274557 20:4224762-4224784 GCCTTCAAAAAAAAAAGAGCAGG + Intronic
1169434424 20:5573082-5573104 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1170846154 20:19963605-19963627 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1171462324 20:25305363-25305385 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
1172050965 20:32117639-32117661 CCCCCCAAGAATAAAACAGATGG + Intronic
1172143496 20:32740809-32740831 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
1172227049 20:33312010-33312032 ACCTCCCCCAAAAAAAGAGAGGG + Intergenic
1172354962 20:34273221-34273243 GCCTCCAAAAAAAAAAAAAAAGG - Intergenic
1172405817 20:34687990-34688012 GCCTCAAACAAAAAAAAAAAGGG + Intergenic
1172540534 20:35712056-35712078 CCCACCAACAAAATAACAAAAGG + Intronic
1172681617 20:36720102-36720124 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1173333004 20:42091102-42091124 GCTTCTTCCAAAAAAACAGAGGG + Intronic
1173426343 20:42946754-42946776 CCATCCAACACAAAAACAGCAGG + Intronic
1173510743 20:43626263-43626285 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
1173776005 20:45706767-45706789 GTCTCAAAAAAAAAAAAAGAGGG + Intronic
1173989747 20:47293050-47293072 GCCTCCAAAAAAAGAAAGGAAGG + Intronic
1174218967 20:48937081-48937103 GTCTCCAAAACAAAAACAAAAGG + Intronic
1174231533 20:49049224-49049246 GTCTCCAAAAAAAAAAGGGAGGG - Intronic
1174291999 20:49515881-49515903 GTCTCAAAAAAAAAAAGAGATGG - Intronic
1174413114 20:50348874-50348896 GTCTCAAAAAAAAAAAAAGATGG - Intergenic
1174429628 20:50458476-50458498 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
1174954669 20:55084208-55084230 GTCTCAAAAAAAAAAAGAGAGGG - Intergenic
1175148869 20:56917351-56917373 GCCTTCAACAGAAAGAGAGAGGG - Intergenic
1175351959 20:58329054-58329076 GCCTCAAAAAAAAAAAAAAAGGG - Intronic
1175410907 20:58768219-58768241 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
1176095891 20:63344490-63344512 GCCTCAAAAAAAAAAAGAAAGGG + Exonic
1176932963 21:14835225-14835247 AACTCAAACAAAATAACAGATGG + Intergenic
1177409212 21:20708142-20708164 ATTTCCAACAAAGAAACAGAGGG - Intergenic
1177760166 21:25394218-25394240 GTCTCAAAAAAAAAAACAAAAGG - Intergenic
1178278459 21:31260107-31260129 GCCTCTAAAAAAAAAAAAAAAGG - Intronic
1178727702 21:35069251-35069273 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1178784634 21:35641998-35642020 GCCTCCAGAAAAAAAAAAAAAGG + Intronic
1179369178 21:40788534-40788556 GCTTCCAAATAAAAAGCAGATGG - Intronic
1179597923 21:42455567-42455589 GCCACAAACAACAAAACAGAGGG + Intergenic
1180499195 22:15917336-15917358 GACTCCATCAAAAAAGAAGAAGG + Intergenic
1181749071 22:24976467-24976489 GCCCCCAACACAACAACAGGGGG - Intronic
1182596479 22:31424809-31424831 GACTCCAAAAAAAAAAAAAAGGG - Intronic
1182677799 22:32053427-32053449 GATTCCACCAAAAAAAGAGAAGG - Intronic
1182681922 22:32086136-32086158 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1183219409 22:36502989-36503011 GTCTCAAAAAAAAAAAGAGATGG - Intronic
1183340166 22:37275681-37275703 ACCACCAACAACAAAAGAGAGGG - Intergenic
1183431226 22:37766950-37766972 GACTCCATCAAAAAAAAAAAAGG + Intronic
1183496864 22:38151246-38151268 GTCTCCAAAAAAAAAAAAGAAGG - Intronic
1183639797 22:39085944-39085966 GCCTCCAGCACAAAATTAGACGG - Intronic
1183711306 22:39505189-39505211 GTCTCCAAAAAAAAAAGAGACGG + Intronic
1183730132 22:39613837-39613859 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1184193679 22:42911939-42911961 ACCTCCACCAAAAAAACCAAAGG + Intronic
1184525227 22:45018772-45018794 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1185270005 22:49925126-49925148 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
1185354090 22:50355963-50355985 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
949494473 3:4619161-4619183 GCTTCCAGCAAGAAAAAAGAAGG - Intronic
949675327 3:6447142-6447164 GCCTCCTAAAAATACACAGATGG - Intergenic
949825757 3:8163521-8163543 GGCTGAAAGAAAAAAACAGAGGG + Intergenic
950322390 3:12069243-12069265 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
951230601 3:20174148-20174170 ACCTCCACCAGAGAAACAGATGG + Intronic
951409988 3:22351807-22351829 CCCTCCACCATAAAAAGAGAAGG + Intronic
951449985 3:22826365-22826387 ACCTCAAACCAAAAAACAAAAGG + Intergenic
951779341 3:26345886-26345908 GCCTCCAACACAAAATAAAATGG - Intergenic
951845959 3:27084800-27084822 GGCTACAAAAAAAAAACAAAAGG - Intergenic
953702802 3:45209951-45209973 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
954265533 3:49468363-49468385 GTCTCCAAAAAAAAAAAAGGGGG - Intergenic
954348961 3:50026381-50026403 GTCTCCAAAAAAAAAAAAAAGGG - Intronic
954470476 3:50690134-50690156 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
954612474 3:51953127-51953149 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
956242651 3:67147626-67147648 GTCTCCAAAACTAAAACAGAGGG + Intergenic
956796963 3:72726351-72726373 GTCTCCAAAAAAAAAAGAAAGGG - Intergenic
957665496 3:83219580-83219602 GTCTCCAAAAAAAAAAAAGGGGG - Intergenic
958047840 3:88306242-88306264 GCAACAAACAAAAAACCAGAAGG - Intergenic
958646889 3:96885833-96885855 GCCTGTAACAAAAAGACTGAAGG - Intronic
958653000 3:96962132-96962154 GTCTCCAACAAAACTGCAGAAGG - Intronic
958708690 3:97690467-97690489 GTCTCCAAAAAAAAAAAAAAGGG - Intronic
959368912 3:105498026-105498048 GCCTCAAAAAAAAAAAAAAAGGG + Intronic
959714090 3:109413753-109413775 GGCTCCAAAAAAAAAAAAAAAGG - Intergenic
960124724 3:113985910-113985932 GCCTTCAACAAAAAAATACAAGG + Intronic
960320860 3:116233710-116233732 GCCACCAAAAAAAGAAAAGATGG + Intronic
961000171 3:123368747-123368769 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
961762286 3:129180001-129180023 GTCTCCAAAAAAAAAAGAAAAGG + Intronic
962547282 3:136449555-136449577 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
963057885 3:141202100-141202122 GCCTTAAACAAAAAAAAGGAGGG - Intergenic
963155344 3:142090561-142090583 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
963544939 3:146644682-146644704 GCCTTAAAAAAAAAAACAAATGG - Intergenic
963597908 3:147351414-147351436 GTCTCCACCTAAAAAACAAATGG + Intergenic
964007935 3:151853628-151853650 GTCTCAAAAAAAAAAAAAGATGG - Intergenic
964662273 3:159133582-159133604 GCCTCCAAGAACAAAATACATGG + Intronic
965205993 3:165719780-165719802 GACTCCAAAAAAAAAAAAAAAGG + Intergenic
965421289 3:168462439-168462461 GCCCCTAAAAAAAAAACTGATGG - Intergenic
966746240 3:183280022-183280044 GTCTCCAAAAAAAAAAAAGGAGG + Intronic
966903969 3:184508443-184508465 TCCTCCAAGGACAAAACAGATGG - Intronic
966964639 3:184978414-184978436 GCCTCAAAAACAAAAAAAGAAGG - Intronic
967041275 3:185695082-185695104 GCCTCAAAAAAAAAAGCAGGGGG + Intronic
967179364 3:186889982-186890004 GTCTCAAAAAAAAAAAAAGAAGG - Intergenic
967516883 3:190380269-190380291 GTCTATAACCAAAAAACAGAAGG - Intronic
969855848 4:9999072-9999094 GCCTGAAAAAAAAAAAAAGAAGG - Intronic
970505145 4:16721563-16721585 TCATCCAACAAAAAAACTGAGGG + Intronic
970587726 4:17530429-17530451 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
971315713 4:25566124-25566146 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
971681851 4:29710070-29710092 GACTCCATCAAAAAAAAAAAAGG + Intergenic
971696645 4:29912836-29912858 GCCTCCAATAAAAAATTACAAGG + Intergenic
972053600 4:34771880-34771902 GCATCCAAAAAGAAAACAGTCGG - Intergenic
972424325 4:38918414-38918436 GCCTCCAGCAAGAAAACAAATGG + Intronic
972470004 4:39395215-39395237 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
973669899 4:53205855-53205877 GTCTCAAAAAAAAAAAAAGATGG + Intronic
973853013 4:54980253-54980275 ACCCCCAACAAAATAACAGCTGG + Intergenic
973939217 4:55887721-55887743 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
973977065 4:56272894-56272916 GCCTCAAAAAAAAAAAAAAAAGG + Intronic
974001013 4:56510773-56510795 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
975117791 4:70698232-70698254 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
975842517 4:78490186-78490208 GACTCCAACAAAATAATAGTGGG + Intronic
976164630 4:82241068-82241090 GACTCTAAAAAAAAAAAAGAGGG + Intergenic
976251241 4:83053835-83053857 GTCTCAAAAAAAAAAAAAGATGG + Intronic
976787799 4:88841738-88841760 GGCTATAATAAAAAAACAGATGG + Intronic
976859107 4:89641182-89641204 GCCTCACACAAAAAAGCAGAGGG + Intergenic
977602104 4:98944544-98944566 GCCTAAAAAAAAAAAAAAGAAGG - Intergenic
977801993 4:101245724-101245746 CCCACCACCAAAAATACAGACGG + Intronic
978375152 4:108067531-108067553 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
979486912 4:121280639-121280661 GACTCCAACACATACACAGATGG - Intergenic
979731859 4:124032936-124032958 TCCTCCAAAAAGAAAAAAGAAGG - Intergenic
980239176 4:130151066-130151088 GACTCCACCAAAAAAACTGTTGG + Intergenic
980565108 4:134529545-134529567 GCCTGCAACCAAAAAACAAGAGG - Intergenic
980915985 4:139033673-139033695 GTCTCCAAAAAAAAAAAAGGGGG + Intronic
981512126 4:145568940-145568962 GACTCCCACACAAAAACAGAGGG + Intergenic
982235147 4:153245135-153245157 GCCTCCACCTACAAAACACAGGG + Intronic
983187236 4:164714007-164714029 GCCTCCAAAAAGAAACGAGAAGG + Intergenic
984139243 4:175982089-175982111 CCCACTAACAAGAAAACAGAGGG - Intronic
984565597 4:181326343-181326365 GTCTCAAACAAAAAAAAAAAAGG + Intergenic
984655603 4:182314296-182314318 GTCTCAAAAAAAAAAAAAGAGGG + Intronic
984666421 4:182434109-182434131 GCCTCCATTAAAAAAAAAAAAGG + Intronic
985481990 5:118851-118873 GTCTCAAAAAAAAAAAAAGAAGG - Intergenic
985737544 5:1593667-1593689 ACCTCCAAGAAAAAAAAAAAAGG + Intergenic
986391184 5:7289493-7289515 GTCTCAAAAAAAAAAATAGATGG + Intergenic
986527933 5:8700936-8700958 GCCTTAAAGAAAAACACAGATGG - Intergenic
986546105 5:8899007-8899029 AAATCTAACAAAAAAACAGAAGG + Intergenic
986735253 5:10663300-10663322 GCTTCAAACTAAATAACAGATGG + Intergenic
988586403 5:32511306-32511328 GGCTCCAAAAAATACACAGAAGG + Intergenic
988823837 5:34915273-34915295 GCCTCCAACAAAACAGGCGATGG + Intronic
988978824 5:36543255-36543277 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
989499264 5:42147427-42147449 GCCTCAAACCAGAAAACAAAAGG - Intergenic
990525761 5:56625721-56625743 GCCTCTAATCAAAAAAGAGAGGG + Intergenic
990587857 5:57229533-57229555 GACTCCATCAAAAAAAGAAAAGG - Intronic
991705080 5:69349900-69349922 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
991726011 5:69536666-69536688 GTCTCAAAAAAAAAAACAAAAGG + Intronic
991921822 5:71664762-71664784 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
991924128 5:71686957-71686979 GCCTACATCAAAAAGACTGAAGG + Intergenic
992306593 5:75446566-75446588 GTTTTCAACAAAAAAACACAAGG - Intronic
992749795 5:79851233-79851255 GCTTCCATCAAAGAAACACACGG - Intergenic
993015931 5:82534620-82534642 CCCTCCAAAAACACAACAGATGG - Intergenic
994160148 5:96548409-96548431 GCCCCTAAGAACAAAACAGATGG - Intronic
994346575 5:98694666-98694688 GACTCCAACACAATAACAGTGGG - Intergenic
994466343 5:100138149-100138171 GGATAAAACAAAAAAACAGAGGG - Intergenic
994504376 5:100622827-100622849 GTCTCGAAAAAAAAAAAAGATGG + Intergenic
994577129 5:101592807-101592829 GTCTCCAAAAAACAAACATACGG + Intergenic
994611858 5:102052030-102052052 GACACCAACAAAGAAAAAGAAGG + Intergenic
994612506 5:102061671-102061693 ACATCCAAGAAAACAACAGAGGG - Intergenic
995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG + Exonic
995846937 5:116503513-116503535 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
996001341 5:118368278-118368300 GACTCCATCAAAAAAAAAAAAGG - Intergenic
996101489 5:119449872-119449894 GCCTCACACCAAAAAACAGAGGG - Intergenic
996747841 5:126860504-126860526 GCTTCCAGCAAATGAACAGAAGG - Intergenic
997109589 5:131060179-131060201 AACTCCTACAAGAAAACAGAGGG + Intergenic
997134841 5:131314232-131314254 GTCTCCAAAAAAAAAAAAAAAGG - Intronic
997493391 5:134298867-134298889 GCCCCCCGCAAAAAAAAAGATGG - Intronic
997973151 5:138420837-138420859 GCCTCCAACAACAAAACCGAAGG + Exonic
998260735 5:140629929-140629951 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
998773644 5:145573865-145573887 GCCTCCAAGAAAAGAGGAGAGGG + Intronic
999227382 5:150037363-150037385 ATCACCAACAAAAAAAAAGAAGG - Intronic
999401115 5:151264977-151264999 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
999505195 5:152187316-152187338 GCAGCCAAAAAAAAAACCGATGG - Intergenic
999552328 5:152702925-152702947 GCCACCAACAAAAAAACAAGAGG - Intergenic
999580188 5:153030015-153030037 GCCTCCAGAAGGAAAACAGAAGG - Intergenic
1000264785 5:159624782-159624804 GCCTACATCAAAAAATCTGAAGG + Intergenic
1000307204 5:160005658-160005680 CCCCCCAAAAAAAAAAAAGAGGG + Intergenic
1002137970 5:177119988-177120010 CCCCCAAACAAAAAAACATAAGG + Intergenic
1002676967 5:180924727-180924749 GGCACCAACACAAAGACAGAAGG + Intronic
1003090235 6:3095845-3095867 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1003537214 6:6985783-6985805 TCCTCCAAAAAAAAAAAAAAAGG + Intergenic
1003866337 6:10366255-10366277 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1003919021 6:10814662-10814684 GCCTCCAAAAAAAAAAGCGGGGG + Intronic
1004475810 6:15970089-15970111 ACCTAAAACCAAAAAACAGAAGG + Intergenic
1004652314 6:17622298-17622320 CCCTCCAAAAATGAAACAGATGG + Intronic
1004710014 6:18160733-18160755 GTCTCAAAAAAAAAAATAGAGGG + Intronic
1005139645 6:22613755-22613777 GCCTCCTAACAAAAAACTGATGG + Intergenic
1005179754 6:23091494-23091516 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1005455678 6:26017614-26017636 GCCTCCAAGAAAAAACCCGCTGG - Exonic
1006324467 6:33343108-33343130 GACTCCGAAAAAAAAAAAGAAGG - Intergenic
1006532477 6:34668676-34668698 GTCTCCAAAAAAAGAAAAGAAGG - Intronic
1006743256 6:36323995-36324017 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1006848355 6:37079199-37079221 GTCTCAAAAAAAAAAAAAGATGG - Intergenic
1006959844 6:37917581-37917603 ACCCCCAGCAAAAAAACAGAAGG - Intronic
1007539233 6:42625814-42625836 GCCTCAAAAAAAAAAAAAGGGGG - Intronic
1007611449 6:43151847-43151869 GCCTCAAATAAAAAAAAAGGCGG - Intronic
1007649202 6:43407337-43407359 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
1007705498 6:43788256-43788278 GGCTCCAGCAAAAATCCAGATGG - Intergenic
1007759133 6:44122083-44122105 GTCTCCAAAAAAAAAAGAGGGGG - Intronic
1007794401 6:44335943-44335965 ACCTTCAACAAAACAACAGCTGG + Intronic
1007864154 6:44949606-44949628 GCCTGCAAAAAAAAAAAAAATGG + Intronic
1008101298 6:47393968-47393990 GTCTCCAAAAAAAAAGCAAAGGG + Intergenic
1008796121 6:55305131-55305153 AACTCCAAGAAAAAAACATAAGG - Intergenic
1009753877 6:67909931-67909953 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1010317738 6:74469856-74469878 TCTTCAAACAAAAAAAAAGAGGG + Intergenic
1010772742 6:79850525-79850547 ACCTCCAACAAAATAATAGCTGG + Intergenic
1011241186 6:85272916-85272938 GCCTGCCACAAAGAAAAAGAGGG - Intergenic
1011402981 6:86984502-86984524 GCCACCAACAAGAAAAAACAGGG + Intronic
1011464076 6:87637245-87637267 GCCCACAAGAAAAGAACAGATGG + Intronic
1011501515 6:87995662-87995684 GCATCCAGCAAAAGAACACAGGG + Intergenic
1013138098 6:107302271-107302293 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
1013603778 6:111729468-111729490 GCCTCAAAAAAAAAAAAAAAGGG + Intronic
1014265428 6:119271500-119271522 GCCTCAAAAAAAAAAAAAGATGG - Intronic
1014609897 6:123529154-123529176 GTCTGCAAGAAAAAAACAGCAGG + Exonic
1015037744 6:128677785-128677807 GCCACCCACAAAAAATCACAAGG - Intergenic
1016156079 6:140810094-140810116 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1016366748 6:143326962-143326984 GTCTCTAACAAAAAATCAGTGGG + Intronic
1016720898 6:147296057-147296079 ACCCCCCAAAAAAAAACAGATGG + Intronic
1016769836 6:147836944-147836966 GAATCCAAAAGAAAAACAGAAGG + Intergenic
1016946425 6:149538849-149538871 GTCTCAAACAAAAAAAAAAAAGG - Intronic
1017125094 6:151057779-151057801 GTCTCAAACAAACAAACAAAAGG - Intronic
1017166134 6:151410055-151410077 GCCTCAAAAAAAAAAAAAAATGG - Intronic
1017347282 6:153398731-153398753 TCCTCCAAATAAAAAACAAAAGG + Intergenic
1017635331 6:156437448-156437470 CACTCCAACAAATAAAAAGAAGG + Intergenic
1017760677 6:157565799-157565821 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1017801913 6:157904427-157904449 GTCTCCAAAAAAAAAATAAAAGG + Intronic
1019691529 7:2417225-2417247 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1019706905 7:2501199-2501221 GTCTCAAAAAAAAAAAAAGAGGG + Intergenic
1020041538 7:5006838-5006860 TCCTCCAAAAAAAAAAAAAATGG - Intronic
1020217308 7:6203719-6203741 GTCTCCAAAAAAAAAAAAGGTGG - Intronic
1020512017 7:9068510-9068532 GACTCCAACAAAATAATAGTGGG - Intergenic
1020589311 7:10114429-10114451 GTCTCCAAAAAAAAAAAAAAAGG - Intergenic
1020665816 7:11041577-11041599 GCCTCCAACAAAAAAACAGAAGG - Intronic
1021392056 7:20104793-20104815 GCCTCCAGCATAAACAGAGAAGG + Intergenic
1021817996 7:24467049-24467071 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1021898258 7:25257818-25257840 GCCTCAAACAAAATCACAAAGGG - Intergenic
1022730273 7:33016369-33016391 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1023336116 7:39172621-39172643 GCCTCAAAAAAAAAAAAAGGAGG - Intronic
1023905684 7:44520275-44520297 GTCTCGAAAAAAAAAAAAGAGGG + Intronic
1024197748 7:47076167-47076189 CCCACCAAAAAAAAAAAAGAAGG + Intergenic
1024298429 7:47864725-47864747 GACTCCATCAAAAAAACGAAAGG - Intronic
1024600330 7:50975004-50975026 GGCTCCAAGAAAAAAACTTACGG - Intergenic
1024826685 7:53398475-53398497 GCCTCCTACAATAACAGAGATGG - Intergenic
1025049105 7:55719260-55719282 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1025118763 7:56281478-56281500 ACCTCCAACCAAACAACAGATGG + Intergenic
1025243896 7:57301431-57301453 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1026058040 7:67002029-67002051 GTCTCAAACAAAAAAAAAAAAGG + Intronic
1026197634 7:68186586-68186608 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1026720050 7:72823008-72823030 GTCTCAAACAAAAAAAAAAAAGG - Intronic
1026861282 7:73791647-73791669 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1027792998 7:82656904-82656926 GCATCCAATAAAAAAACACCAGG + Intergenic
1027836096 7:83245420-83245442 GTCTCCAAAAATAAAAAAGAGGG - Intergenic
1028501274 7:91521171-91521193 GCCTCATACAAAAAGGCAGAGGG + Intergenic
1028634927 7:92977293-92977315 TCTTCCAAAAATAAAACAGAGGG - Intergenic
1029103487 7:98153859-98153881 GTCTCAAAAAAAAAAAGAGAGGG + Intronic
1029187927 7:98752880-98752902 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
1029584047 7:101458646-101458668 GTCTCCAAAAAAAAAAGAAATGG + Intronic
1030126727 7:106160256-106160278 GACTCCACCAAAAAAACTCATGG - Intergenic
1030198399 7:106876392-106876414 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1030291386 7:107876129-107876151 GCCTCCAGAAAAAAATTAGATGG + Intergenic
1031088757 7:117327937-117327959 GACTCTAACAAAAAAAAAGGTGG - Intergenic
1031963231 7:128008463-128008485 CCCTCCAAAAAAAAAAAAAAAGG - Intronic
1032181903 7:129687275-129687297 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1032320637 7:130883431-130883453 GTCTCAAAAAAAAAAAAAGATGG + Intergenic
1032797685 7:135290716-135290738 GCCTCACACAAAAAGGCAGAGGG + Intergenic
1033375545 7:140758455-140758477 GTCTCCAAAAAAAAAAGTGAAGG - Intronic
1033921575 7:146399558-146399580 TCCATCAACAAATAAACAGATGG - Intronic
1034158499 7:148974998-148975020 GTCTCAAACAAACAAACAAAAGG + Intergenic
1034779117 7:153860646-153860668 GCCTTCAAAAAAAAAAAAAAGGG + Intergenic
1035047316 7:155976479-155976501 ACATCCAACAAGAAAACACAAGG - Intergenic
1036563287 8:9916224-9916246 GCCTAAAAAAAAAAAAGAGAAGG + Intergenic
1036924521 8:12891705-12891727 GCATCCAACTAAGCAACAGAAGG - Intergenic
1037496472 8:19445849-19445871 GCCTCCAAACCAAAAACATATGG - Intronic
1037938708 8:22933000-22933022 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1038254755 8:25941206-25941228 GTCTCGAAAAAAAAAAAAGATGG - Intronic
1038726922 8:30089764-30089786 GCCTCAAAAAAAAAAAAAAAGGG + Intergenic
1038766648 8:30434699-30434721 GCCTCGAAAAAAAAAAAAAAAGG + Intronic
1039632535 8:39128130-39128152 GACTCCCACAAAATAACAGTGGG - Intronic
1040912795 8:52538083-52538105 GCCTCCGAAAAAAAAAAAAAAGG + Intronic
1042143035 8:65698728-65698750 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1042607614 8:70562138-70562160 GCCTACATCAAAAAAGAAGATGG + Intergenic
1043007044 8:74832523-74832545 GGCACCATTAAAAAAACAGAGGG - Intronic
1043528999 8:81129234-81129256 GACTCCATCAAAAAAAAAAAAGG - Intergenic
1044598457 8:93980808-93980830 GCCACCAGCAGAAAACCAGAAGG - Intergenic
1044637628 8:94342350-94342372 TCCTCCATTAAAGAAACAGAAGG + Intergenic
1044769008 8:95609601-95609623 GACTCCATCAAAAAAAGAGAAGG - Intergenic
1045213321 8:100121643-100121665 GCCTCAAACCAAAAACCACAAGG + Intronic
1046659264 8:116931737-116931759 AACTCCATCAAAAAAAAAGAGGG - Intergenic
1046667330 8:117018673-117018695 GACTCCATCAAAAAAAAAAAGGG - Intronic
1046801249 8:118430370-118430392 GACTCCATCAAAAAAAAAAAAGG - Intronic
1046984057 8:120367939-120367961 GTCTCGAAAAAAAAAAAAGAAGG + Intronic
1047116996 8:121854078-121854100 GCCTCCATCAAGAAGACAGAAGG + Intergenic
1047388864 8:124433441-124433463 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1047508363 8:125497507-125497529 GCCTTAAACACAAAGACAGAGGG - Intergenic
1047591602 8:126332913-126332935 GCTTACAACAAAAAATGAGAAGG + Intergenic
1047894471 8:129350953-129350975 GCCTGCATCAGAAAAAAAGAGGG + Intergenic
1047896930 8:129376583-129376605 GCTTCCAACAAAAAAATACAAGG + Intergenic
1047990563 8:130282064-130282086 GCCTCGAAAAAAAAAAAAAAAGG + Intronic
1048778274 8:137972007-137972029 GCATCACACAAAAAAAGAGAAGG - Intergenic
1049239603 8:141530524-141530546 GCCTGCAACAGACAAACAGAAGG + Intergenic
1049853668 8:144848494-144848516 GTCTCAAAAAAAAAAAAAGATGG + Intronic
1050094980 9:2055046-2055068 GACTCCAAGGAAAAACCAGAAGG + Intronic
1050096119 9:2068917-2068939 GTCTCAAAAAAAAAAACAAAAGG - Intronic
1050466975 9:5937224-5937246 GCCTCAAAAAAAAAAAAAAAGGG + Intronic
1051245714 9:15108886-15108908 GCCTCCAGAAAAAAAAAAAAAGG + Intergenic
1052268967 9:26606403-26606425 TCCTCCAAGAAAAAAAAAAAAGG + Intergenic
1052392436 9:27896100-27896122 CCTTGCAACAGAAAAACAGAGGG + Intergenic
1052775345 9:32727449-32727471 GCCTCAAAAAAAAAAAAAGAGGG - Intergenic
1055244850 9:74227328-74227350 GCCTACAACAAAAAGTCTGAAGG + Intergenic
1055566289 9:77571751-77571773 GCCTTCAAAAAAAAAAAAAAAGG + Intronic
1055881108 9:81004700-81004722 GCTTCCAACAAAAAATGACAAGG + Intergenic
1056132578 9:83600699-83600721 GCCTCTAAAAACAAAAAAGATGG + Intergenic
1056175880 9:84035656-84035678 GACGCCAACAAAAAAACTAAAGG - Intergenic
1056311694 9:85347471-85347493 GCTTCCAAAAACAAAACACAGGG + Intergenic
1056388943 9:86122746-86122768 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1056430710 9:86525331-86525353 ACCTCCAAAAAAAAAAAAAAAGG + Intergenic
1056775575 9:89510072-89510094 GCCTAAAACAAAACAAAAGATGG - Intergenic
1056790568 9:89622771-89622793 TCTTCCAACTGAAAAACAGAAGG + Intergenic
1056897366 9:90563560-90563582 GCCTACAAAAATAAAACAGTTGG - Intergenic
1057438424 9:95063559-95063581 GCCACCAGCAAAACAACACAGGG - Intronic
1057487260 9:95495264-95495286 GCCACCAACCAAAAAACGGAAGG + Intronic
1057905508 9:98980156-98980178 GTCTCAAAAAAAAAAAAAGAGGG + Intronic
1057935782 9:99237634-99237656 GCCACCAACAAAAAAACCTTGGG + Intergenic
1058841555 9:108914393-108914415 GTCTCCAAAAAAAAAAAAAAAGG + Intronic
1059802474 9:117764091-117764113 GCCTCAAAAAAAAAAAAAAATGG - Intergenic
1060340378 9:122770057-122770079 GCCTCCCACACAATAACAGTGGG + Intergenic
1060948707 9:127586836-127586858 GCCTCAAAAAAAAAAAAAAAAGG - Intergenic
1061072453 9:128319639-128319661 GCCTCAAAAAAAAAAAAAAAAGG - Intronic
1061667981 9:132171346-132171368 GCCTCTCACAACATAACAGAAGG + Intronic
1061978976 9:134088974-134088996 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1062095503 9:134701153-134701175 GCCACCTGCAAAGAAACAGATGG - Exonic
1187030806 X:15486294-15486316 GTCTCAAAAAAAAAAAAAGAAGG + Intronic
1187176922 X:16904354-16904376 GTCTCCAAGAAAAAAAAAGTAGG + Intergenic
1187209622 X:17216422-17216444 GCCTCAAAAAAAAAAAAAAATGG + Intergenic
1187241871 X:17521362-17521384 GTCTCAAAAAAAAAAAAAGAGGG - Intronic
1188306820 X:28569240-28569262 CACTCCTACAAAAAAAAAGATGG + Intergenic
1188430253 X:30098992-30099014 GCCTATAACAAAAAAACAGGAGG + Intergenic
1188506191 X:30887763-30887785 GACTCCATCAAATAAACATATGG + Intronic
1188917319 X:35927881-35927903 TGCTGCAAGAAAAAAACAGAAGG - Intronic
1189167238 X:38872245-38872267 GCATCCAAGAAGAAAACTGATGG - Intergenic
1189372781 X:40442948-40442970 TCCTCAAACAGATAAACAGATGG + Intergenic
1189629843 X:42941360-42941382 GCCTCTAAAAAAAAAATAGATGG - Intergenic
1189728596 X:43994483-43994505 GTCTCAAAAAAAAAAAAAGAAGG + Intergenic
1190400383 X:50027753-50027775 GCTTTCAACAAAAAAATACAAGG - Intronic
1190794445 X:53727833-53727855 GCCTCAAAAAAAAAAAAAAAAGG + Intergenic
1190944777 X:55081294-55081316 GCCCCCAATAAAATAATAGATGG - Intergenic
1191801154 X:65081107-65081129 ACCTCAAACTAAAAAACATATGG + Intergenic
1192109893 X:68353151-68353173 GTCTCAAACAAAAAAAAAGAAGG + Intronic
1192474599 X:71429270-71429292 GTCTCAAAAAAAAAAGCAGAAGG + Intronic
1193111789 X:77737418-77737440 GTCTCCAAAAAAAAAAAAGGGGG + Intronic
1193549527 X:82872830-82872852 GACTCAACCAAAAAAACAGAAGG - Intergenic
1194593714 X:95833417-95833439 GACTCCTACACAAAAACAGTGGG - Intergenic
1194639273 X:96383236-96383258 GCCTCCAGCCAGAAAGCAGAAGG + Intergenic
1195649724 X:107272446-107272468 GCCTCTTAGAAATAAACAGAGGG + Intergenic
1195793765 X:108621153-108621175 GTCTCAAAAAAAAAAAAAGAAGG - Intronic
1196202763 X:112904193-112904215 CCCTTCAACAAAAAATCACAAGG + Intergenic
1196819528 X:119692128-119692150 GTCGCCAACAAAAAAAGAGACGG + Intronic
1197087464 X:122496073-122496095 GACTCCTACAAAATAACAGTGGG - Intergenic
1197667253 X:129237366-129237388 ATCTCCAAAAACAAAACAGATGG + Intergenic
1198542366 X:137653221-137653243 GTCTCCAAAAAAAAAAAAAAAGG + Intergenic
1198548225 X:137716741-137716763 GACTCCAACAAAATAATAGTTGG - Intergenic
1199291503 X:146110037-146110059 GTCTCAAAAAAAAAAACATAAGG - Intergenic
1199924880 X:152451557-152451579 GCATCCAACAGAGAAATAGAGGG + Intergenic
1200790165 Y:7292544-7292566 GCCTCCAAAAAAAAAAAAAAAGG - Intergenic
1202098308 Y:21277840-21277862 GCCTCAAAAAAAAAGAAAGAAGG - Intergenic
1202580359 Y:26374402-26374424 GGCTCCAAAATAAAGACAGAAGG + Intergenic