ID: 1020666138

View in Genome Browser
Species Human (GRCh38)
Location 7:11046474-11046496
Sequence CTCTGTAAACTATTCCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020666138 Original CRISPR CTCTGTAAACTATTCCTAGA AGG (reversed) Intronic
902141826 1:14363209-14363231 CTCTATAAACTACTCCTGGAAGG + Intergenic
902687902 1:18090884-18090906 TTTTGTAACCTAATCCTAGAAGG + Intergenic
903744651 1:25578419-25578441 CTCTGTAATCTATCACCAGATGG - Intergenic
906806208 1:48781124-48781146 CACTGTAAATCATTCCTATAAGG + Intronic
908863257 1:68514521-68514543 CTCTGCAAAGCATTCCAAGATGG - Intergenic
909844099 1:80368715-80368737 CTCTCTAAAGGAGTCCTAGATGG - Intergenic
911331919 1:96534271-96534293 CACTGTGAACTATTGCTACAGGG + Intergenic
913496661 1:119433812-119433834 CTCTGTACACGCTTCCCAGAAGG - Intergenic
913501496 1:119476342-119476364 CTCTGTACACGTTTCCCAGAAGG - Intergenic
915435744 1:155904488-155904510 GGCTGTAAACTCTGCCTAGAGGG + Exonic
915782139 1:158563776-158563798 GTCTGTTAACTTTTCCTATAAGG - Intergenic
916631319 1:166616919-166616941 CTCCATAAACTATTTATAGATGG - Intergenic
918527517 1:185480990-185481012 ATCTTAAAACTATTGCTAGATGG - Intergenic
918780853 1:188698079-188698101 CTCAACAAACTATGCCTAGAAGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063331323 10:5162437-5162459 CTCTCTAAAATTGTCCTAGATGG - Intergenic
1069397932 10:68010172-68010194 CCCTGTATCCCATTCCTAGAAGG + Intronic
1075123809 10:119683612-119683634 CTCTGAAAAGTATTCCAACATGG - Intergenic
1077449617 11:2630845-2630867 CTGTGTAAAGTATTCTTAGATGG + Intronic
1077671157 11:4158781-4158803 CTCTGTAAAATATTTGAAGAGGG + Intergenic
1077704792 11:4474743-4474765 CCCTGGATACTCTTCCTAGAAGG + Intergenic
1082179486 11:49101057-49101079 CTCTGGAAACTATTCCCGCATGG - Intergenic
1086685798 11:89731860-89731882 CTCTGGAAACTATTCCTGCATGG + Intergenic
1090335644 11:125961613-125961635 ATATGTAAACTAATCATAGAGGG + Intronic
1090340656 11:126017142-126017164 CTCCGGAAACTATTCCTGCATGG - Exonic
1091637656 12:2209658-2209680 CTCTGGAAAATATTCACAGAGGG + Intronic
1093527745 12:20122406-20122428 CTCCATAAAATATTTCTAGAGGG + Intergenic
1095781043 12:46059874-46059896 CTCAATAAACTAGTACTAGAAGG + Intergenic
1099561301 12:84177749-84177771 CTCTATAAACTATACATATAGGG + Intergenic
1101140293 12:101789004-101789026 GTCTGTAATTTATTCCTAAAAGG + Intronic
1102777610 12:115534130-115534152 CTCTGTAAATTATTGTTAAAAGG + Intergenic
1103246947 12:119465872-119465894 CTCTGTAAAATATTCCAAAGAGG - Intronic
1103991031 12:124799632-124799654 CTCTGTAAAATATGCCCAGTTGG - Intronic
1104580180 12:130005845-130005867 CTCTGTACACTGTTCCTAACCGG - Intergenic
1106620722 13:31368029-31368051 CCCTTTAAATTAGTCCTAGATGG - Intergenic
1110520169 13:76466337-76466359 CTGTGAAGACTAGTCCTAGATGG - Intergenic
1111591854 13:90357862-90357884 CTCAGTGAACTAGTACTAGAGGG + Intergenic
1111594999 13:90400143-90400165 CTGAGTAAACTATTCTTTGATGG + Intergenic
1112979657 13:105367476-105367498 CACTGTGAAATATTCATAGAAGG - Intergenic
1115067325 14:29279904-29279926 ATCTGTTACCTCTTCCTAGATGG + Intergenic
1116699488 14:48221414-48221436 CTCTCAACACTATTCCTAGCTGG + Intergenic
1117320576 14:54619428-54619450 CTATGTAACATATTCTTAGAGGG + Intronic
1117341235 14:54793747-54793769 CTCTGTTAACTATTCCCACCTGG + Intergenic
1118918676 14:70130057-70130079 CTCAGTAAACAATTCATTGAGGG - Intronic
1121816265 14:96931478-96931500 CTCAGTAAACTCGTCCAAGATGG - Intronic
1125772249 15:42176789-42176811 TCCTGTAAACTATTTCTAAAAGG - Intronic
1127157492 15:56143528-56143550 CACTGTAAACTTTTACTATATGG + Intronic
1127853292 15:62934180-62934202 CTCTCTGAACTATTCCTGAAAGG + Intergenic
1130144515 15:81263707-81263729 CTCTGTGAACCATTCCAAGTTGG + Intronic
1131135533 15:89932057-89932079 CTCTGAAAAGTGTTCCTATATGG + Intergenic
1132323884 15:100949829-100949851 CTCAGTAAACTAGTAATAGAAGG + Intronic
1135264792 16:21014424-21014446 CTCAGTAAACTAGTAATAGAGGG + Intronic
1137741187 16:50776576-50776598 CTGTGTAAAATAATCCTATATGG + Intronic
1138223269 16:55271079-55271101 CTCTCTAAAATATTCCTATGAGG + Intergenic
1138980905 16:62267047-62267069 CTCAGTATACTAGTCATAGAAGG + Intergenic
1143072093 17:4304858-4304880 CTCTTCAAACAATTCCAAGATGG + Intronic
1144296224 17:13877519-13877541 CTCTTTTATCTATTCCAAGATGG - Intergenic
1153942133 18:9987621-9987643 CTCTGGAATCCATTCCTAGGAGG - Intergenic
1155721949 18:29026245-29026267 CTCTTTAAACTGTTTTTAGATGG + Intergenic
1156857527 18:41799570-41799592 CTCTGTAAACTATTTTTACAGGG - Intergenic
1157305899 18:46517337-46517359 CACTGCAAACTATACCCAGATGG - Intronic
1159624853 18:70680822-70680844 CTCTATCAACTATTTGTAGAAGG + Intergenic
1161192155 19:2963839-2963861 CTCTGTAAATTATTGCTAGAAGG - Intergenic
1163971275 19:20797637-20797659 CACTGTAACCTCTTCCTCGAGGG + Intronic
1164086475 19:21907287-21907309 CTCTGTAAAAAATACCAAGATGG - Intergenic
1165369373 19:35394731-35394753 CTATGTAAATTAATCCTAAATGG + Intergenic
1166108270 19:40608201-40608223 CTCTCTTACCTATTCCCAGAGGG + Exonic
1167086296 19:47311933-47311955 ATCTGTAAACTGTTTCTGGAAGG - Intronic
925616169 2:5746398-5746420 CTCTTTAAGCTATTCTTGGAAGG + Intergenic
926786911 2:16526996-16527018 TTGTGTAAGCTATTCCTACATGG - Intergenic
926887660 2:17612839-17612861 CTTTGGAAACTCTTCCTTGAGGG - Intronic
929220631 2:39461704-39461726 TTCTGTAAGCTACTCCTATACGG - Intergenic
929256057 2:39813038-39813060 CTCTGGAAACTTTTCCCTGAGGG + Intergenic
932670856 2:73737121-73737143 CTCACTAAACTATTTCTTGAGGG + Intronic
933932483 2:87167755-87167777 GTCGGTAAACTATTTCTAAAAGG - Intergenic
934611957 2:95745971-95745993 CTCAGTAAACTAGTACTAGAGGG + Intergenic
934842197 2:97633480-97633502 CTCAGTAAACTAGTACTAGAGGG - Intergenic
934955014 2:98609748-98609770 CTCGGTAACATCTTCCTAGATGG - Exonic
936360628 2:111797686-111797708 GTCGGTAAACTATTTCTAAAAGG + Intronic
938850324 2:135253018-135253040 CTTTGTCAAGGATTCCTAGAGGG - Intronic
941355982 2:164491974-164491996 ATCTAAAAACTATTCCCAGATGG + Intergenic
941697353 2:168567621-168567643 TTCTGCAAACTATGGCTAGAGGG - Intronic
942933008 2:181518738-181518760 GTCTGTAAACTACTCCCTGAAGG - Intronic
943321983 2:186455894-186455916 CTCAGTAAAATGTTCCTACATGG + Intergenic
947006520 2:225517901-225517923 CTCTGTTCACTATTCCTTAATGG - Intronic
1171877221 20:30588074-30588096 CTCAGTAAACTAGGCATAGAAGG - Intergenic
1172416874 20:34776550-34776572 CTCTGTTAGCTATTCCAAGCTGG - Intronic
1174244794 20:49170209-49170231 TTCTGTAAACCATTTCTAGAAGG - Intronic
1174710327 20:52697647-52697669 CCCTATTACCTATTCCTAGATGG + Intergenic
1178751319 21:35306250-35306272 CTCTGTAAACTGTTAATAGCAGG - Intronic
1180623846 22:17180789-17180811 CTCTGTACACTTTTCCTGGGTGG - Exonic
1181709618 22:24674271-24674293 CTCTGTAATCTCTACCTGGAGGG + Intergenic
1182501535 22:30751653-30751675 CTCTGTAAAATATTTGAAGAGGG - Intronic
1203288796 22_KI270735v1_random:13486-13508 CTCACTAAAATATTCTTAGAAGG + Intergenic
949481653 3:4499923-4499945 CTCTGTAAACTTTGCTTAGGTGG + Intronic
951419504 3:22467599-22467621 CTCTGTAAAGTAGCCATAGAGGG + Intergenic
951516836 3:23569241-23569263 ATCTGAAAACTTTTCCTAAATGG - Intronic
953552847 3:43917822-43917844 CTCTGTTTAATATACCTAGATGG + Intergenic
954591889 3:51789992-51790014 TTCTGTAACCAAGTCCTAGATGG + Intergenic
956642257 3:71426306-71426328 ATCTGTAAACTCTTGTTAGATGG + Intronic
957432642 3:80132079-80132101 TTCTGCAAACAATTCCTACAGGG - Intergenic
957854397 3:85855293-85855315 CCCTCTAAACTATTTCTTGAGGG + Intronic
958728329 3:97933241-97933263 CTCTTAAAAATATTCCTAGGAGG - Intronic
961691684 3:128674635-128674657 CTCTGTCCCCCATTCCTAGAAGG + Intronic
963348781 3:144127803-144127825 CTCTGTAAATTATTTTTAGTAGG + Intergenic
964389521 3:156183121-156183143 CTCTGTATACTCTTCCCAGATGG - Intronic
967047201 3:185748468-185748490 CTATGTAACCTATTACTGGAGGG - Intronic
970675680 4:18447835-18447857 CTCAGGAAACTATTAATAGAAGG + Intergenic
971137465 4:23885354-23885376 CTCAATAAACTATTGCTAAATGG + Intronic
972629588 4:40832070-40832092 CACTGTGATCCATTCCTAGATGG - Intronic
975003553 4:69257399-69257421 CTCAGTAAACTAGTCGTTGATGG - Intergenic
975467836 4:74730064-74730086 CTCAGTAAACAATTATTAGAGGG - Intergenic
975690623 4:76959016-76959038 CTCTGAAAAGTATTCCAACATGG - Intronic
976937696 4:90658697-90658719 CTTTTTAAGTTATTCCTAGAGGG - Intronic
977003774 4:91538851-91538873 ATTTATATACTATTCCTAGAGGG - Intronic
977317098 4:95463836-95463858 CTCTCTAGACTGTTCCTAGGGGG - Intronic
978413923 4:108455576-108455598 CTCTGTATACTCTTTCTAGATGG + Intergenic
981148211 4:141350259-141350281 CTCTATAAAAAATCCCTAGAAGG - Intergenic
981422944 4:144572068-144572090 CTCTGTAAAATATTTCAAGAGGG - Intergenic
981683497 4:147427184-147427206 CTCTCTATAAAATTCCTAGATGG - Intergenic
982226544 4:153172509-153172531 CTCTGGAAACACTTCCTGGAAGG + Intronic
982381229 4:154750815-154750837 TTCCTTAAACTATTCCTACAAGG - Exonic
983822905 4:172218315-172218337 CTTTGTAAAATATGCCTAGAGGG - Intronic
985514310 5:332091-332113 CTCTGGAAACTATACATACATGG - Intronic
989101712 5:37829469-37829491 AGCTGTAAACTATTGCTAGGTGG - Intronic
989149699 5:38286759-38286781 CTGTGTAAACTATAGCAAGATGG - Intronic
989157779 5:38360728-38360750 CAATGCAAACTATTCCTACATGG + Intronic
989713824 5:44435040-44435062 CTCTGTAAATTATTTCAAGGCGG - Intergenic
990378655 5:55199545-55199567 CTCAGAAAACTATTTATAGAAGG - Intergenic
993956957 5:94245876-94245898 CTCTTTAAACTCTTAATAGAAGG + Intronic
994728011 5:103459301-103459323 ATCTGTAATCTCTTCTTAGATGG + Intergenic
996076094 5:119196327-119196349 ATCTGTTAACTATTTCTATAGGG - Intronic
997476613 5:134146205-134146227 CTCTCTTCACTATTCCTAGGAGG + Exonic
998965827 5:147539402-147539424 CTCAGTAAACTAATCCCAGCTGG + Intergenic
1000571481 5:162919898-162919920 CTCTGCAAACTATTTATAGATGG - Intergenic
1003136670 6:3439709-3439731 CTCTGTAAACACTTCCTGCATGG - Intronic
1004811718 6:19270264-19270286 CTGTGTATACTATTCTTGGATGG - Intergenic
1007493116 6:42239770-42239792 CTCGGCAAACTATGCTTAGAAGG + Intronic
1010137181 6:72569342-72569364 CTCAGTAAACTAGGACTAGAAGG + Intergenic
1011035624 6:82971215-82971237 TTCTGAAAACTTTTCCTAAATGG - Intronic
1011835749 6:91429529-91429551 CTCTGTAAAATACTCTTAAAAGG + Intergenic
1013837565 6:114350586-114350608 CTCTCTTAACTCTTCCTGGATGG + Intergenic
1014005872 6:116417753-116417775 TTCTGGAAACAATTGCTAGAAGG - Intronic
1017373171 6:153736437-153736459 CTCTGTAGCCTATTCATGGAGGG + Intergenic
1020666138 7:11046474-11046496 CTCTGTAAACTATTCCTAGAAGG - Intronic
1020857036 7:13441042-13441064 CTCTGTAAATAATTCCTAAAAGG + Intergenic
1022574163 7:31481785-31481807 GTCTGCAAACCCTTCCTAGAAGG - Intergenic
1024284065 7:47741884-47741906 CTCTGTGGAATATTCTTAGACGG + Intronic
1024782595 7:52868922-52868944 CTCTGCAAACTAGGCATAGAAGG + Intergenic
1025562440 7:62385128-62385150 CTCAGTAAAATACTCTTAGAAGG - Intergenic
1026577482 7:71584494-71584516 CACTGTAAAGTATTTATAGATGG - Intronic
1030301022 7:107975061-107975083 CTCTGGGAACAATTCCTGGAGGG - Exonic
1031568917 7:123333938-123333960 CTCAGCAAACTATCCATAGAAGG + Intergenic
1033087872 7:138358874-138358896 TTCTGTGAACTATTACTAGAGGG + Intergenic
1035939625 8:3883565-3883587 TTTTGCAAACTATTCCTTGAAGG - Intronic
1038585019 8:28780484-28780506 CTCTGTAAACAATTCCTAACAGG + Intronic
1039749796 8:40467262-40467284 CTCAGTAAACTAAGCATAGAAGG + Intergenic
1040141856 8:43928246-43928268 CTCAGTAAACTATCACAAGAAGG + Intergenic
1041321471 8:56618437-56618459 CTCTGTAAGGTGTTCCTAGTTGG + Intergenic
1043367311 8:79548491-79548513 CTCTGGGAACTTTTCCTTGAAGG - Intergenic
1043389130 8:79774563-79774585 CACTGTAAATTATTCTTTGAGGG - Intergenic
1044888997 8:96812495-96812517 TGCTGTAAAATATTCCTTGAGGG + Intronic
1046247579 8:111585054-111585076 CTCTGAAATCTATGCCTATAAGG + Intergenic
1050399588 9:5237542-5237564 CTCTGTAAATTATTCCTTACAGG + Intergenic
1051824751 9:21208717-21208739 CTCACTTAACTTTTCCTAGAAGG + Intronic
1054946503 9:70801885-70801907 CACTGAAAACTATCCCAAGAAGG + Intronic
1057920233 9:99091315-99091337 ATGTGTAAACTACTCCTTGAGGG - Intergenic
1060534185 9:124370075-124370097 CTCTGTAAACTGTTGATAGACGG - Intronic
1187953338 X:24492207-24492229 ATCTGTATATTATTCCTAAAAGG - Intronic
1193316314 X:80069584-80069606 CTCAGTAAACTAGGCATAGAAGG - Intergenic
1193651183 X:84135120-84135142 CTCTATAAACAATTCCTAATTGG + Exonic
1194209135 X:91048186-91048208 CTCTGTAAACCAATTCTTGAAGG + Intergenic
1196289767 X:113925697-113925719 CTCTGTAAACTGTGTATAGAAGG - Intergenic
1199560358 X:149156427-149156449 CTCTGTCAATTATTGATAGAGGG + Intergenic
1201643822 Y:16205611-16205633 CTCTCTAAACTAATCCTGGTTGG - Intergenic
1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG + Intergenic