ID: 1020670832

View in Genome Browser
Species Human (GRCh38)
Location 7:11108744-11108766
Sequence TAGTGTAGCAAACTTGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020670832 Original CRISPR TAGTGTAGCAAACTTGTTCT TGG Intronic
910275894 1:85448889-85448911 CAGTTTAACAAACTTGTTCTTGG - Intronic
915900725 1:159844874-159844896 TAGTGTAAGGAACTTGATCTTGG + Intronic
918380384 1:183948116-183948138 TAGTGAAGCCATCTGGTTCTAGG - Intronic
919230312 1:194764895-194764917 AAGTGTAGCATACTTGCTCATGG + Intergenic
1073408402 10:103318835-103318857 TAGTGTAGGAAACTTTTTGCAGG + Intronic
1079802031 11:24880640-24880662 TAGATTAGCAAACTTGCTGTGGG + Intronic
1080100162 11:28450839-28450861 TAATGTATTAAACATGTTCTAGG + Intergenic
1090614662 11:128504079-128504101 TAGTGCAGGAAACTTGAGCTGGG - Intronic
1091093665 11:132796471-132796493 TAGTGGTGCAAAGTTGTTTTTGG - Intronic
1099045966 12:77719899-77719921 CAGTGAAGCCATCTTGTTCTCGG + Intergenic
1099105060 12:78486652-78486674 CTGTGTAGCAAACTTGTGCCTGG + Intergenic
1102811346 12:115826891-115826913 TATTGGAGCAAAGGTGTTCTAGG - Intergenic
1119627494 14:76192159-76192181 TTGTGTAGCAGGCTTGTTCTGGG + Intronic
1127718337 15:61673895-61673917 TTGTGCAGCAAACTTGTGCTAGG - Intergenic
1127859927 15:62985420-62985442 TAGTGTTCCTAACTTGTTTTTGG + Intergenic
1131965982 15:97842739-97842761 TAGTGTTGCAAAATTATCCTTGG - Intergenic
1137783587 16:51118487-51118509 GTGTGAAGCAAAATTGTTCTAGG + Intergenic
1142571678 17:878621-878643 TACTGTAGCCAGGTTGTTCTGGG + Intronic
1148966373 17:51439388-51439410 TAGAGTAGCTAACTTGTTCAAGG + Intergenic
1154979562 18:21491407-21491429 TAGTGTTCAAAAATTGTTCTGGG + Intronic
1155373917 18:25135453-25135475 TTGTGTAGCAAACCTGGTCATGG - Intronic
1156604289 18:38647453-38647475 AAGTGGTGCAAACTTGGTCTTGG + Intergenic
1164570276 19:29369498-29369520 TAGTGTAGGAACCCTGTGCTGGG - Intergenic
1167810581 19:51826400-51826422 TAGTGAAGCCAACTGGATCTTGG + Intergenic
928178675 2:29052501-29052523 GAGTGTAACAAACGTGTTCAGGG + Exonic
931069954 2:58635261-58635283 TAGAGTAGAAAACTTGATCAAGG - Intergenic
934887267 2:98035731-98035753 TAATTTGGAAAACTTGTTCTTGG + Intergenic
937459460 2:122073302-122073324 GAGTTTAGCCAACTTGATCTGGG - Intergenic
937730326 2:125222528-125222550 CACTGTAGCAAACTTCTTCCTGG + Intergenic
938373004 2:130785524-130785546 CAGTGTCGCAAAGCTGTTCTTGG - Intergenic
941233762 2:162943953-162943975 TAGTGAAGCAATCTGGTCCTGGG - Intergenic
943072769 2:183161139-183161161 TAGTGTAGCAACCTCCTTCTTGG - Exonic
945146378 2:206742665-206742687 GAGTGTAGCACACTTCTTCATGG - Intronic
946583261 2:221153922-221153944 GAGTGCAACAAACTTGTTCAGGG - Intergenic
947458160 2:230276120-230276142 TAGTGTAGCCATCTTCATCTAGG - Intronic
1171378864 20:24717067-24717089 TGGTGAAGCTAACTTGTTCTGGG + Intergenic
1178138967 21:29660191-29660213 TAGTCTAGCCTAGTTGTTCTTGG + Intronic
1185060566 22:48604390-48604412 TGGTGTTCCAGACTTGTTCTGGG + Intronic
949168812 3:973521-973543 TGGTGTAGCAAAATTGGACTGGG - Intergenic
949382946 3:3465957-3465979 CAGTGTACCAGACTTGATCTAGG + Intergenic
950133665 3:10565221-10565243 CAGGGTAGAAAACTTTTTCTAGG - Intronic
952186959 3:30980353-30980375 TGGAGCAGCAAACTTTTTCTGGG + Intergenic
957015275 3:75055972-75055994 TAGTGTACAAAATTTGTTCTTGG - Intergenic
962565267 3:136651546-136651568 TTTTGTAGCAAAATTGATCTTGG + Intronic
963575296 3:147053254-147053276 TATTGTAACAACCTTGTTATCGG - Intergenic
964298785 3:155263876-155263898 TAGTTAAGCAAAATTGTTTTAGG + Intergenic
965678198 3:171222051-171222073 TAATGTTGCAAGCTTGTTTTGGG - Intronic
967235492 3:187379903-187379925 TAGTGTCTCACACTTGGTCTTGG - Intergenic
971213098 4:24638970-24638992 TAGGCTAGTAAAATTGTTCTTGG + Intergenic
971486890 4:27169769-27169791 TTGTCTAGAAAACTAGTTCTAGG - Intergenic
972478598 4:39476686-39476708 TAATGTAGCAAAATTGCTCTTGG + Intronic
972673865 4:41240520-41240542 TTGTGTAGAAAACTTCTACTAGG - Intergenic
976343194 4:83967429-83967451 TAGTTTAGCCAGCTTGTTCTAGG + Intergenic
977081687 4:92537596-92537618 TAATATAGCATATTTGTTCTGGG - Intronic
978350906 4:107819723-107819745 TATTTTAACAAACTTATTCTGGG + Intergenic
980442518 4:132867414-132867436 TAGAGCACCAAACATGTTCTTGG + Intergenic
981931253 4:150191387-150191409 TAGGTTAGCAAACCTGTTCCAGG + Intronic
983973082 4:173898239-173898261 AAATGTAGCACATTTGTTCTTGG + Intergenic
986455292 5:7912273-7912295 CACTGCAGCAAACTTGTTCCCGG + Intergenic
987967066 5:24891124-24891146 AAGTCTAGCATACTTCTTCTTGG - Intergenic
988716443 5:33833525-33833547 TATTTTAGCTAACTTGTTCTAGG - Intronic
988770790 5:34431095-34431117 TAATGAAGCCAACTTGATCTTGG + Intergenic
988911901 5:35851879-35851901 TAGGCTAGCAGAGTTGTTCTTGG + Intergenic
992660259 5:78952880-78952902 TGGTGTAGCAAAATTATTCCTGG - Intronic
993302588 5:86229478-86229500 TAATGTAGAAAACTTACTCTAGG - Intergenic
994570813 5:101511339-101511361 AAGTGTATCAAACTGGTTGTGGG + Intergenic
999796538 5:154994205-154994227 TGGTGTAGCAAACATGATATAGG - Intergenic
1001973405 5:175976364-175976386 TAGTGAAACCATCTTGTTCTAGG - Intronic
1002013156 5:176300972-176300994 TAGTGAAGCCACCTTGTTCTAGG - Intronic
1002214680 5:177621776-177621798 TAGTGAAGCCACCTTGTTCTAGG + Intergenic
1003812501 6:9800499-9800521 TAGTTTCACAATCTTGTTCTGGG - Intronic
1011655933 6:89552060-89552082 TAGTGGACCAAACTTGCTCATGG + Intronic
1012413022 6:98981211-98981233 TAGTGCAGCACACATGTACTTGG - Intergenic
1013222576 6:108091975-108091997 GATTGTGGCAAACTTATTCTTGG + Intronic
1017871439 6:158489929-158489951 GGGTGTAGCAAACTTCTACTGGG - Intronic
1020670832 7:11108744-11108766 TAGTGTAGCAAACTTGTTCTTGG + Intronic
1024490354 7:49975324-49975346 AAGTGTACCAAACTTGCTCCCGG - Intronic
1024667273 7:51559460-51559482 CACTGTAGCAAACTTCTGCTTGG - Intergenic
1027724799 7:81790457-81790479 AAGTTTAGAAATCTTGTTCTTGG + Intergenic
1032732157 7:134654377-134654399 CAGTGTAGCAAAATGGTTCAGGG + Intronic
1034203742 7:149298424-149298446 TCATGTAGCAAATTTATTCTAGG + Intergenic
1040853732 8:51927589-51927611 TACTGGAGCAAACTTTTTGTTGG + Intergenic
1041245871 8:55888133-55888155 CAGTTTAGCAAACTTTTCCTGGG + Intronic
1042813701 8:72854622-72854644 AAATGTAGCTAACTTGTGCTAGG + Intronic
1043704383 8:83330321-83330343 TCCTGCAGCAAACTTTTTCTTGG + Intergenic
1044620119 8:94182158-94182180 TAGTGAAGCCATCTGGTTCTGGG - Intronic
1045726234 8:105176637-105176659 TTGTGCATCCAACTTGTTCTGGG + Intronic
1052230895 9:26151282-26151304 CAATGTAGAAAACTTGTGCTAGG - Intergenic
1056239431 9:84629550-84629572 TACTGTAGCAAAAATGTTCTTGG - Intergenic
1058272899 9:102997163-102997185 TAGTCTAGAAAACTTTTTGTTGG + Intronic
1059879704 9:118677230-118677252 AATTGTAGCACATTTGTTCTTGG - Intergenic
1061345236 9:130018794-130018816 TAGTGTAGCTAAATTGTACAAGG + Intronic
1185942403 X:4336309-4336331 TAGTGTAGCAAACTTGGGATTGG + Intergenic
1192302960 X:69925492-69925514 GAATGAAGCAAACTTGATCTTGG + Intronic
1193272687 X:79547253-79547275 TAAGGTAGAAAACCTGTTCTGGG - Intergenic
1193465189 X:81839684-81839706 TTGTCTACCAAACTTTTTCTTGG + Intergenic
1199376724 X:147121334-147121356 TAGTGCAGCAAACATGTGCGGGG + Intergenic