ID: 1020671778

View in Genome Browser
Species Human (GRCh38)
Location 7:11124073-11124095
Sequence TTCTGAAGAAAGTTGGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020671774_1020671778 13 Left 1020671774 7:11124037-11124059 CCTTACTTTTTCCTTTTCTTTTT 0: 1
1: 17
2: 232
3: 2092
4: 15710
Right 1020671778 7:11124073-11124095 TTCTGAAGAAAGTTGGTATCAGG No data
1020671775_1020671778 2 Left 1020671775 7:11124048-11124070 CCTTTTCTTTTTTCTAACTCCAC 0: 1
1: 0
2: 5
3: 71
4: 749
Right 1020671778 7:11124073-11124095 TTCTGAAGAAAGTTGGTATCAGG No data
1020671773_1020671778 30 Left 1020671773 7:11124020-11124042 CCTCTCACTGTTTTTCTCCTTAC 0: 1
1: 0
2: 3
3: 50
4: 520
Right 1020671778 7:11124073-11124095 TTCTGAAGAAAGTTGGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020671778 Original CRISPR TTCTGAAGAAAGTTGGTATC AGG Intronic
No off target data available for this crispr