ID: 1020672719

View in Genome Browser
Species Human (GRCh38)
Location 7:11137936-11137958
Sequence CTTTATACAAGGAAAGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020672719_1020672721 23 Left 1020672719 7:11137936-11137958 CCTAGCTCTTTCCTTGTATAAAG 0: 1
1: 0
2: 3
3: 18
4: 270
Right 1020672721 7:11137982-11138004 ACAGACCAGCAGTATATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020672719 Original CRISPR CTTTATACAAGGAAAGAGCT AGG (reversed) Intronic
905824234 1:41017017-41017039 ATTTTTAAAAGGAGAGAGCTTGG + Intronic
906506078 1:46380604-46380626 GTTAATCCAAGCAAAGAGCTTGG - Intergenic
908918856 1:69166171-69166193 TTTTAGACAAGGAAATGGCTTGG + Intergenic
910331629 1:86079273-86079295 TTTTGTACAAGGCAAGAGATAGG - Intronic
910519521 1:88103604-88103626 TTTTGTACAAGGAAAGCCCTTGG + Intergenic
910791189 1:91052900-91052922 CTTTATGCAAAGAAAGACTTAGG + Intergenic
911020611 1:93383393-93383415 GTTTATTCAAGGAAAAAGCTGGG + Intergenic
911444653 1:97976167-97976189 CTTTATTCAAGGAAAGAATGGGG + Intergenic
913273180 1:117113912-117113934 CTTCATACAAGGATAGAGTGAGG - Intronic
913601298 1:120423908-120423930 ATTTCAACATGGAAAGAGCTAGG - Intergenic
914085746 1:144452687-144452709 ATTTCAACATGGAAAGAGCTAGG + Intronic
914191641 1:145416668-145416690 ATTTCAACATGGAAAGAGCTAGG + Intergenic
914362486 1:146947466-146947488 ATTTCAACATGGAAAGAGCTAGG - Intronic
914489184 1:148139631-148139653 ATTTCAACATGGAAAGAGCTAGG + Intronic
914589568 1:149094670-149094692 ATTTCAACATGGAAAGAGCTAGG + Intronic
916341414 1:163740079-163740101 TTTTATATAAGGCAAGAGATAGG + Intergenic
917502994 1:175602967-175602989 CTTTATTCTAGGAAAGATTTGGG - Intronic
919524158 1:198626646-198626668 TTTTATGCAAGGAAATAGCATGG + Intergenic
921018594 1:211215253-211215275 CTTTTTAGAGGGAAAGAGATGGG + Intergenic
922093495 1:222420587-222420609 CCTTCTTCAAAGAAAGAGCTAGG + Intergenic
923064032 1:230501584-230501606 GTTTATTCAAGTAAAAAGCTGGG + Intergenic
924310395 1:242735586-242735608 CTTTATATATTGAAAGAGCAAGG - Intergenic
924674109 1:246158037-246158059 CTTTAAATAAGTAAAGAGCCAGG + Intronic
924703696 1:246480294-246480316 CTTTTTAAAATGAAAGAGCCTGG - Intronic
924896237 1:248340124-248340146 CTTTTTAAAAGGAAATTGCTGGG + Intergenic
1063868335 10:10391043-10391065 TTTTATATATGGAGAGAGCTCGG - Intergenic
1065409353 10:25406507-25406529 GTTTATTCAAGCAAAAAGCTGGG + Intronic
1065821497 10:29529873-29529895 ATAAATTCAAGGAAAGAGCTGGG + Intronic
1066598070 10:37074755-37074777 CTTAATACAAGGTTAAAGCTGGG - Intergenic
1068274585 10:54776911-54776933 GTTTATACAAAGAAAGAACTAGG + Intronic
1068523215 10:58100581-58100603 GTTTATTCAAGCAAAAAGCTGGG - Intergenic
1068922250 10:62496999-62497021 CTTTATCAAAGAAAAGAGCAAGG + Intronic
1069082678 10:64104992-64105014 CTTCATAGAAAGACAGAGCTTGG + Intergenic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1071156238 10:82692612-82692634 CCTTATGCAGGGAAGGAGCTCGG - Intronic
1072956846 10:99894395-99894417 CTTGAGGCAAGGAAAGACCTAGG + Intronic
1075198057 10:120378356-120378378 CGTTAGCCAAGCAAAGAGCTGGG - Intergenic
1076130350 10:128009747-128009769 ATTTAAACAATGAAGGAGCTGGG - Intronic
1077564492 11:3288476-3288498 TTTTATAGATGGAAAGAGCGAGG - Intergenic
1077570382 11:3334293-3334315 TTTTATAGATGGAAAGAGCGAGG - Intergenic
1078644587 11:13128788-13128810 TTGTATACAAGCAAAGAGCTTGG - Intergenic
1082843178 11:57706032-57706054 CTTTACATAAGAAAAGAACTGGG + Intronic
1083752297 11:64767252-64767274 CTTGATGGAAGGAAAGAGCAGGG + Intronic
1084470894 11:69358456-69358478 TTTTCTTCAAGGAAAGAACTGGG - Intronic
1084613330 11:70218207-70218229 CTTTTTAAGAGGAAATAGCTAGG + Intergenic
1085144343 11:74179646-74179668 CTTTATGAAAGGAAACAACTAGG - Intronic
1086133104 11:83420910-83420932 CTTTTTAAAAGGAAATTGCTGGG - Intergenic
1086168507 11:83808324-83808346 CATAATTCAAGGAAGGAGCTGGG - Intronic
1086847028 11:91763614-91763636 CTTTATAAAAGGAAAGCCCTAGG + Intergenic
1087049440 11:93870410-93870432 GTTTATTCAAGCAAAAAGCTGGG - Intergenic
1087158515 11:94927027-94927049 CTTTAAACAAGGAGCCAGCTGGG - Intergenic
1087506140 11:99024006-99024028 CTTTATAGCAGGAAAGAGACTGG + Intronic
1087521583 11:99244416-99244438 TTTTCTACAAGGAATGAGGTAGG - Intronic
1087534870 11:99430658-99430680 CTATATAGAGAGAAAGAGCTTGG + Intronic
1087853144 11:103056782-103056804 TTTTATAAAAAGAAATAGCTAGG - Intergenic
1088371208 11:109090276-109090298 TTTTTTACAAGGAAATAGGTTGG + Intergenic
1088429199 11:109739629-109739651 ATTTAGACAAGGAAAGAGGGTGG - Intergenic
1089362088 11:117897770-117897792 TTTCATAGAAGGAAGGAGCTGGG - Intergenic
1090608347 11:128448465-128448487 CCTGAGACAAGGAAAGAGGTGGG + Intergenic
1090631325 11:128651696-128651718 GTTGATAGAAGGAAAGAGTTTGG - Intergenic
1090881347 11:130833916-130833938 CTTTAAAGAAGGAAATAGCTTGG - Intergenic
1091688468 12:2580067-2580089 ATTTATATAAGGACAGAGTTGGG + Intronic
1091915106 12:4266579-4266601 CTTGACACCAGGAAAGAGTTTGG + Intergenic
1092026289 12:5243482-5243504 CTTTTTTGAAGCAAAGAGCTAGG + Intergenic
1093126214 12:15331277-15331299 CTTTATATTAGGAAATAGGTAGG + Intronic
1096939466 12:55326070-55326092 CTTAACAGAAGGAAAGAGGTTGG + Intergenic
1098106327 12:67071181-67071203 ATGTATACAAGCAAAGACCTAGG + Intergenic
1100116150 12:91306837-91306859 CTTTATAAATGCATAGAGCTTGG - Intergenic
1102081614 12:110102879-110102901 CTTTATAAAAGGAAAGACTGGGG - Intergenic
1103299085 12:119913919-119913941 GTTTATTCAAGCGAAGAGCTGGG - Intergenic
1104555127 12:129792782-129792804 CATTATCGAAGGGAAGAGCTGGG + Intronic
1105552952 13:21415126-21415148 CTATAAACAAGGCAATAGCTTGG + Intronic
1107071143 13:36270742-36270764 TTTTATAGAAGGTAAGAGATAGG - Intronic
1109195497 13:59373687-59373709 GTTTTTACATGGACAGAGCTGGG - Intergenic
1109826617 13:67729835-67729857 TTGTATGCAAGGAAAGATCTAGG + Intergenic
1110828118 13:79997002-79997024 CTTTATAAATTGAAAGAGCAGGG - Intergenic
1111634533 13:90886970-90886992 AGTTATTCAAGGAAAGAGCCTGG + Intergenic
1114364160 14:22009159-22009181 CTATAAACATGGGAAGAGCTGGG + Intergenic
1115470870 14:33767143-33767165 CCTTGTGCAAGGAAAGACCTAGG + Intronic
1118576330 14:67244924-67244946 CTTTAAAAAAGGAAAGAGAGAGG + Intronic
1118721377 14:68596623-68596645 GTTCATAGAAGGAAACAGCTGGG + Intronic
1119372598 14:74160158-74160180 CTTTATACAAAGGAAAAGTTTGG + Intronic
1120751037 14:88198645-88198667 CCCTATACAAGGAAAGCACTGGG - Intronic
1120772082 14:88390142-88390164 ATTTATACCAGCAAAGTGCTTGG + Intronic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1121861074 14:97318873-97318895 TTTTATACAAGAAAAGATCGAGG - Intergenic
1125188382 15:36959698-36959720 CTTTATACATGTAAAGAACTGGG + Intronic
1125967492 15:43886157-43886179 TTTTATAAAATGATAGAGCTGGG + Intronic
1127626444 15:60784831-60784853 CTTCACACAAGGACACAGCTAGG - Intronic
1127729828 15:61789547-61789569 CTTTATATAAGGAAGGAGGCAGG - Intergenic
1129099076 15:73241616-73241638 CTTTATAGAAAGAAAGCACTGGG - Intronic
1130755467 15:86758251-86758273 CCTTGTAGAAGGAAGGAGCTTGG - Intronic
1132068017 15:98749095-98749117 TTTTAAACAAGGAAAGAAATAGG - Intronic
1132102714 15:99036338-99036360 CTGCAGTCAAGGAAAGAGCTGGG + Intergenic
1132965120 16:2649179-2649201 TTTTATAGAAGAAATGAGCTTGG + Intergenic
1133773447 16:8880991-8881013 CTTTACACAAGGATACAGCCAGG - Intergenic
1133986820 16:10675190-10675212 ATTTATACACAGAAAGAACTTGG - Intronic
1134297178 16:12957238-12957260 CTTTCTACAAGCATAGGGCTTGG + Intronic
1135340541 16:21643140-21643162 CTTTATAGAAGAAGAGTGCTCGG - Exonic
1135700973 16:24632145-24632167 TTTCAAACAAGGAAAGAGCCTGG - Intergenic
1138445901 16:57063409-57063431 CCTTAAAAAAGGAAAGGGCTGGG - Intronic
1138484608 16:57330322-57330344 CTATTTACAAGTAAAGAGATTGG - Intergenic
1138694146 16:58795881-58795903 AATTATACAAGAAATGAGCTGGG + Intergenic
1141974564 16:87506938-87506960 ATGTATAGACGGAAAGAGCTTGG - Intergenic
1143858088 17:9867494-9867516 TCTTATACAAAGAAAGAGGTGGG - Intronic
1145114511 17:20196663-20196685 TTTTATATAAGAAAAGATCTTGG - Intronic
1148119989 17:45202946-45202968 ATTTATAAAAGGAACGGGCTGGG - Intergenic
1148792424 17:50180871-50180893 CTTTCTCCAATGACAGAGCTGGG - Intergenic
1149227595 17:54492823-54492845 CATTATAGAAGGAAAGAAGTAGG + Intergenic
1150319224 17:64197248-64197270 CTTTCTGCAAGGAAAAATCTAGG - Intronic
1152191963 17:78893752-78893774 CATTATAAAAGGAAAGAGCTGGG - Intronic
1156393909 18:36680382-36680404 ATTTATCCAAGGATATAGCTTGG - Intronic
1156725818 18:40125314-40125336 GTTTCTAGAATGAAAGAGCTAGG + Intergenic
1157305838 18:46517000-46517022 CTATAAGCAAGGCAAGAGCTAGG + Intronic
1157907234 18:51580372-51580394 CTCTATAGGAGGAAAGAACTCGG - Intergenic
1158334146 18:56396364-56396386 CTTTTTACAAGGATATATCTGGG + Intergenic
1158850099 18:61487401-61487423 CTTTCTAGAAGGTAAAAGCTGGG - Intronic
1161886912 19:7004034-7004056 ATTAAAACCAGGAAAGAGCTGGG + Intergenic
1162361083 19:10221008-10221030 CTTTATGCCTGGAAAGTGCTCGG + Intronic
1162952919 19:14082457-14082479 CTTTATTCATGGTAGGAGCTAGG - Exonic
1164397925 19:27882041-27882063 CTTTTTCCAAGTAAAAAGCTTGG - Intergenic
1164945927 19:32293020-32293042 ATTAATACAGGTAAAGAGCTGGG - Intergenic
1166646812 19:44538340-44538362 TTTTAAAAAAGGAAAGAGATTGG + Intergenic
1167003985 19:46763477-46763499 TTTTAAAAAAGGAAAGAACTGGG + Intronic
1168068477 19:53934472-53934494 CTTTTTACAATGAAAAAGCAAGG + Intronic
925627089 2:5852368-5852390 TCTTGTACAAGGAAGGAGCTTGG + Intergenic
925796702 2:7553484-7553506 CTGGACACAAGGCAAGAGCTGGG - Intergenic
926348554 2:11973445-11973467 CTTTATAAAAGTAAAGAAATGGG - Intergenic
926781137 2:16473007-16473029 CTTTATGCAATGAAAGAGTCTGG - Intergenic
927112682 2:19875253-19875275 GTTTATTCAAGCAAAAAGCTGGG + Intergenic
928789320 2:34932268-34932290 CTTTATACAAGAAAATAATTTGG - Intergenic
928794107 2:34995775-34995797 CTTCAGAAAAAGAAAGAGCTGGG + Intergenic
929549907 2:42883430-42883452 CTTTATACAAGCAGAAATCTGGG + Intergenic
930003155 2:46874835-46874857 CTTTTTAGGAGGAAAGAGCCAGG + Intergenic
932500486 2:72178871-72178893 CTCAATACAAGGAAAGGGCATGG - Exonic
932989457 2:76768595-76768617 ATTTATATATGGAAAGAGTTAGG + Intronic
936141535 2:109946259-109946281 CTTTAAAAAAAAAAAGAGCTGGG - Intergenic
936178224 2:110244207-110244229 CTTTAAAAAAAAAAAGAGCTGGG - Intergenic
938001247 2:127740541-127740563 CTCTAAAAAAGAAAAGAGCTGGG + Intronic
938547023 2:132343380-132343402 ATTTACACAAGGTAAGAGCAAGG - Intergenic
938918743 2:135972399-135972421 TTTTATATAAGGTAAGAGATGGG - Intronic
939416433 2:141904531-141904553 CTTTATACAAGTGAAGACCTTGG + Intronic
939502403 2:143004296-143004318 CTTTCTACCAGTAGAGAGCTGGG - Intronic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
939872803 2:147543536-147543558 CTTTATACAAAGGATGAGTTTGG + Intergenic
941626286 2:167834319-167834341 CTTTTTATAAGGAAAAACCTAGG - Intergenic
942892420 2:181007519-181007541 CTTTATACTTGGAAATACCTGGG + Intronic
944116021 2:196186974-196186996 CTTTATAGAAGGTAATAGTTGGG + Intergenic
945168350 2:206969608-206969630 CTTTATACGAGGAATTAGTTAGG + Intergenic
946017658 2:216616986-216617008 CTCTATAGAAAGAAAGGGCTGGG + Intergenic
946200960 2:218070513-218070535 CTTTGTGTAAGGAGAGAGCTGGG + Exonic
947066567 2:226233083-226233105 CTTTCAACAAGAAAGGAGCTAGG - Intergenic
1169703742 20:8478904-8478926 CATTATACATGTAAAAAGCTTGG + Intronic
1169712082 20:8575848-8575870 TTTTATATAAGTAACGAGCTTGG + Intronic
1170450232 20:16475489-16475511 GTGTAAACAAGGAAGGAGCTGGG + Intronic
1170799128 20:19575952-19575974 CTTTATACAGGGAGATAGCTGGG + Intronic
1171300075 20:24052374-24052396 GTTTAGAAAAGGAAAGGGCTGGG + Intergenic
1171875888 20:30576117-30576139 ATTTACACAAGGTAAGAGCAAGG - Intergenic
1173131430 20:40397771-40397793 TTTTACACAAGAAAAGTGCTGGG + Intergenic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1174385841 20:50188300-50188322 GTTAATACATGCAAAGAGCTTGG + Intergenic
1176347225 21:5760259-5760281 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176354039 21:5880843-5880865 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176497602 21:7564196-7564218 ATTTATAAAAATAAAGAGCTGGG - Intergenic
1176541546 21:8158329-8158351 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1176560497 21:8341374-8341396 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1177305742 21:19313008-19313030 CCTTATACCAGGAATGAGATAGG + Intergenic
1178097904 21:29235257-29235279 GTTTATTCAAGCAAAAAGCTGGG - Intronic
1178127341 21:29529435-29529457 CTTAATCAGAGGAAAGAGCTGGG - Intronic
1178961199 21:37067233-37067255 TTATATAAAAGGAAAGTGCTGGG - Intronic
1179042914 21:37820283-37820305 GTTTATTCAAGCAAAAAGCTGGG - Intronic
1179102002 21:38362184-38362206 CTTTACACAAGGACATGGCTGGG - Intergenic
1179139908 21:38716095-38716117 CTTTATACAGGGATAGAGCATGG - Intergenic
1181912796 22:26253542-26253564 TTTTGTACAAGCAATGAGCTCGG - Intronic
1183610504 22:38900365-38900387 TTTTCCTCAAGGAAAGAGCTTGG - Intergenic
1203246485 22_KI270733v1_random:74748-74770 ATTTATAAAAATAAAGAGCTGGG + Intergenic
949843243 3:8342980-8343002 TTTTATTAAAGGAAAGACCTGGG - Intergenic
952705240 3:36370594-36370616 CCTTAGACAATTAAAGAGCTAGG + Intergenic
954000807 3:47555229-47555251 CTTTATCCAAGGCAGGAGCCAGG - Intergenic
954903368 3:54039476-54039498 ATTTTTACAAGGACAGAGCGAGG + Intergenic
956365306 3:68495510-68495532 CTTAATCCAAGGAAAGTCCTTGG + Intronic
956501912 3:69896035-69896057 GTTTATCAAAGGACAGAGCTAGG - Intronic
958706066 3:97657324-97657346 CTTTATATAAGAAAACAACTTGG - Intronic
959310759 3:104733834-104733856 AGTTGTACAAGGAAAGGGCTAGG + Intergenic
960389523 3:117059696-117059718 CTTTATCTATTGAAAGAGCTGGG + Intronic
961710003 3:128820793-128820815 CTTTATGCCAGGAAAGAGAAAGG + Intergenic
962293153 3:134154313-134154335 CCTTATACAACAAAAGGGCTCGG + Intronic
964355084 3:155843211-155843233 CTTTATTCAAGGAAAGTGCTAGG + Intronic
964736015 3:159918348-159918370 GTTTATTCAAGCAAAAAGCTGGG + Intergenic
966367601 3:179206617-179206639 CTTTATAAAAGTAAAAGGCTGGG + Intronic
967436951 3:189458222-189458244 CTTCAGACAAGCAAACAGCTTGG + Intergenic
970511212 4:16783492-16783514 CTTTAAACAAAGCAAGAGCCAGG - Intronic
970674598 4:18434508-18434530 CTTTGTACAATGAAAATGCTAGG - Intergenic
971687994 4:29795137-29795159 CTGTATGCAAGAAAAGAACTTGG + Intergenic
973759767 4:54105136-54105158 TTTTAAACAGGAAAAGAGCTGGG + Intronic
973846876 4:54921811-54921833 CTTCATAAGTGGAAAGAGCTGGG - Intergenic
974085395 4:57255220-57255242 TTTTATTCAAGGAAAGAGGCTGG + Intergenic
974731640 4:65874374-65874396 CTTTATTCAAGGATACAGTTGGG + Intergenic
975031899 4:69631156-69631178 CTTTAGAAAAGCAGAGAGCTAGG + Intronic
975397872 4:73898551-73898573 CTTTAAAAGAGAAAAGAGCTGGG + Intergenic
976389009 4:84490715-84490737 TTTTATAAAAGGACAGAGGTGGG - Intergenic
976915555 4:90370095-90370117 CTGTATACAAGGAAACATGTTGG + Intronic
979399823 4:120235350-120235372 CTTTATAGATGAAAAGATCTTGG + Intergenic
980486818 4:133468256-133468278 CTATATACTAGGTAAGAGCAGGG + Intergenic
980747759 4:137041916-137041938 TTTAATACTAGGAAAGAGCTTGG + Intergenic
980823419 4:138045129-138045151 CTTTATGCAGGGCAGGAGCTGGG - Intergenic
981669521 4:147271837-147271859 CTTCATACAATTAAGGAGCTTGG + Intergenic
982411441 4:155081875-155081897 CTTTATGGAATGAAAGAACTGGG - Intergenic
982576819 4:157122496-157122518 TTTTATACTAGGAAAGGGCATGG - Intronic
983315095 4:166121988-166122010 CTTAATACAGGGAAAGAGTTTGG + Intergenic
984161488 4:176257664-176257686 CTATATAAAAGGAAAGATATTGG - Intronic
985969857 5:3366265-3366287 GATTTTTCAAGGAAAGAGCTTGG - Intergenic
987247965 5:16068532-16068554 CTTTATAGCAGCAAAGAGCAAGG - Intronic
987621963 5:20346406-20346428 CCTTACAAAAGGAAAGAGCTTGG + Intronic
989438041 5:41437580-41437602 CTTTAAAGTAGGAAGGAGCTTGG + Intronic
992127904 5:73661288-73661310 CTTCATACAATGGAAGAGTTAGG + Intronic
993173283 5:84449138-84449160 GTTTACACAAGCAAAGATCTTGG + Intergenic
994979479 5:106855128-106855150 CCTTATGCAAGGGAGGAGCTGGG + Intergenic
995016947 5:107320667-107320689 CTTAATACAGGGATAGAACTGGG - Intergenic
995156049 5:108914801-108914823 CTTTTGAAAAGGGAAGAGCTAGG - Intronic
997099272 5:130950413-130950435 TTTTATATAAGGTAAGAGATGGG - Intergenic
999234552 5:150082622-150082644 TTTTATAGCAGGAAACAGCTTGG + Intronic
1001437541 5:171711984-171712006 CTTTATAAAAGGAAAGACCCAGG + Intergenic
1002260143 5:177987581-177987603 CCTTACACAAGGAACGATCTTGG - Intergenic
1003126866 6:3362726-3362748 CTTTCTCCATGGAGAGAGCTGGG - Intronic
1003809296 6:9761965-9761987 GTTTATACAAGTATAAAGCTGGG - Intronic
1005463545 6:26090887-26090909 CTTCAAACAAGGAAAGACCAAGG - Exonic
1005964932 6:30720590-30720612 CTTTTTACAAGGAAAAATCCAGG + Intronic
1006586061 6:35113796-35113818 CTAAATACAAGTAAAGAGTTTGG + Intergenic
1007695277 6:43728371-43728393 CTGAAAACAAGTAAAGAGCTTGG - Intergenic
1008159824 6:48063425-48063447 CTTTATACTAAGAAAGAAGTAGG - Intronic
1008428761 6:51390149-51390171 CTTTGTATAAAGAAAGAGCTAGG + Intergenic
1008908948 6:56712212-56712234 ATTTATATAAGTAATGAGCTAGG - Intronic
1013059157 6:106615079-106615101 GTTTATGCAAGAAAACAGCTGGG + Intronic
1013438731 6:110139535-110139557 GTTTATTCAAGCAAAAAGCTGGG - Intronic
1013815432 6:114092132-114092154 CTTTGTAAAAGTAAAGAGCTGGG + Intronic
1017489575 6:154933220-154933242 TTTTATGCAAGAAAAGAGCTGGG + Intronic
1017730064 6:157307414-157307436 ACTTATACAAGGAAACAGGTGGG + Intronic
1018256510 6:161925129-161925151 CTTTATATAAGGAAAAATTTGGG - Intronic
1019344638 7:523216-523238 AATTATACAAGGAAAGAGCTTGG - Intergenic
1020672719 7:11137936-11137958 CTTTATACAAGGAAAGAGCTAGG - Intronic
1022993582 7:35731692-35731714 CATGTTACAAGGAAAGAGCTAGG + Intergenic
1023171224 7:37391796-37391818 TTTTATACAAGGAACGATTTGGG + Intronic
1026687871 7:72527570-72527592 CTTTACACAAAGAAACTGCTAGG + Intergenic
1026723090 7:72849418-72849440 CTTTACACAAAGAAACTGCTAGG + Intergenic
1027387363 7:77671827-77671849 GTTTATAGAAGAAGAGAGCTGGG - Intergenic
1027952394 7:84834141-84834163 CTGTATAAAAGCAAAGAGGTAGG - Intergenic
1028416982 7:90590925-90590947 CTTTATAAAAGGAAACATTTTGG + Intronic
1029697871 7:102226263-102226285 GCTTATACCAGCAAAGAGCTCGG + Intronic
1029966290 7:104744179-104744201 CTCTGTACAAGTAAAGAGTTTGG + Intronic
1031558604 7:123209277-123209299 TTTTATACATGGACAAAGCTTGG - Intergenic
1032659980 7:133972175-133972197 CTTTAACCAATGAGAGAGCTGGG + Intronic
1033071239 7:138204682-138204704 GTTTATTCAAGCAAAAAGCTGGG - Intergenic
1034127009 7:148682225-148682247 CTTTATACATGGCAGGAGATAGG - Intergenic
1035472373 7:159118666-159118688 CTTTCTATAATGAAAGAACTTGG - Intronic
1036460281 8:8946591-8946613 CTTTATACAACAACAGAGCCTGG + Intergenic
1038563721 8:28602089-28602111 CTTTTTAAAAGGAAATAACTAGG + Intronic
1040551181 8:48438846-48438868 CTGTGGACATGGAAAGAGCTGGG + Intergenic
1040713275 8:50215687-50215709 CTTTTTGAAAGGAGAGAGCTTGG - Intronic
1040714991 8:50240270-50240292 CTTCATAAAAGAAAAGTGCTTGG - Intronic
1041220028 8:55641262-55641284 CTACATACAAGGAAATAGCCAGG + Intergenic
1042391905 8:68245811-68245833 CTTTATAAAAGGCAGTAGCTAGG + Intergenic
1042706025 8:71666200-71666222 CTTTTTAAAAGGAAATTGCTGGG - Intergenic
1043331794 8:79125869-79125891 CTATATACAAGGAAATATCATGG + Intergenic
1044493019 8:92843104-92843126 TTTTATATCAGGAAGGAGCTTGG - Intergenic
1045035011 8:98170072-98170094 CTTTATAGAGGGAAGGAGGTCGG + Intergenic
1046032308 8:108797799-108797821 TACTATACAAGGAAAGAGGTGGG + Intergenic
1046316758 8:112513004-112513026 CTTTATAGAATTAAAGAGTTAGG + Intronic
1046865942 8:119150486-119150508 CTTTAGAAAGGGAAAGAGTTAGG - Intergenic
1047604851 8:126464991-126465013 GTTTATTCAAGCAAAAAGCTGGG - Intergenic
1047897264 8:129380690-129380712 CTTTATAGAATTGAAGAGCTAGG - Intergenic
1049144963 8:140993204-140993226 CTTGATACCAGGGAAGAACTTGG - Intronic
1050330571 9:4541229-4541251 GTTTATTCAAGCAAAAAGCTGGG + Intronic
1052749246 9:32472348-32472370 ATGTCTACAAGGAAAGAGCCTGG + Intronic
1055043915 9:71905707-71905729 CTTTATGCAAGAAAAGTGCCTGG - Intronic
1055345793 9:75337175-75337197 CTTTATTCAAGGACTGGGCTGGG - Intergenic
1056629724 9:88283305-88283327 CTTTAAAGAAGGACAGGGCTTGG - Intergenic
1057295534 9:93834934-93834956 ACTTATACAAGTAAAGAGTTTGG - Intergenic
1058247419 9:102645298-102645320 ATTTATTCAAGAGAAGAGCTGGG + Intergenic
1203462820 Un_GL000220v1:57820-57842 ATTTATAAAAATAAAGAGCTGGG + Intergenic
1187879759 X:23835882-23835904 TTTTCTACAAGGATTGAGCTGGG - Intronic
1189067274 X:37823807-37823829 CACTATAAAAGGAAAAAGCTGGG + Intronic
1189266223 X:39718665-39718687 ATTGATACAAGGAATGAGCTAGG - Intergenic
1190554050 X:51615867-51615889 CTTACTTCAAGGAAAGAGCAAGG - Intergenic
1192594415 X:72391405-72391427 ATTTATAAATGGAAAGAGATAGG + Intronic
1193822129 X:86178312-86178334 ATTTATACAAAAAAAGAGATAGG - Intronic
1195797649 X:108668650-108668672 CTTCTTACAAGTAAATAGCTTGG + Intronic
1196035697 X:111141483-111141505 CTTTTTACTAGCAAAGTGCTGGG + Intronic
1196247709 X:113420026-113420048 TTTTGTACATGGAAAGAGATAGG - Intergenic
1196581772 X:117388334-117388356 ATTTTTACAAGGAAACAACTTGG - Intergenic
1198500307 X:137238099-137238121 CTTTATTAAAAGAAATAGCTGGG + Intergenic
1198866296 X:141126919-141126941 ATTAATACAAGTAAAGTGCTTGG + Intergenic