ID: 1020674655

View in Genome Browser
Species Human (GRCh38)
Location 7:11167490-11167512
Sequence ATAGTTCAGAAAATATTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020674653_1020674655 9 Left 1020674653 7:11167458-11167480 CCTTTTATTCGTTCATTATTCCA 0: 1
1: 0
2: 3
3: 52
4: 564
Right 1020674655 7:11167490-11167512 ATAGTTCAGAAAATATTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020674655 Original CRISPR ATAGTTCAGAAAATATTGAT TGG Intronic
No off target data available for this crispr