ID: 1020675453

View in Genome Browser
Species Human (GRCh38)
Location 7:11178609-11178631
Sequence TTGTATTTTCAGTTCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020675447_1020675453 0 Left 1020675447 7:11178586-11178608 CCGCCATCACACCCAACTAATTT No data
Right 1020675453 7:11178609-11178631 TTGTATTTTCAGTTCAGACGGGG No data
1020675448_1020675453 -3 Left 1020675448 7:11178589-11178611 CCATCACACCCAACTAATTTTTG 0: 49
1: 1768
2: 23790
3: 65288
4: 134095
Right 1020675453 7:11178609-11178631 TTGTATTTTCAGTTCAGACGGGG No data
1020675446_1020675453 1 Left 1020675446 7:11178585-11178607 CCCGCCATCACACCCAACTAATT No data
Right 1020675453 7:11178609-11178631 TTGTATTTTCAGTTCAGACGGGG No data
1020675445_1020675453 28 Left 1020675445 7:11178558-11178580 CCTCTGGAGTAGCTGGGATTACA 0: 1585
1: 9600
2: 121775
3: 258562
4: 224343
Right 1020675453 7:11178609-11178631 TTGTATTTTCAGTTCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020675453 Original CRISPR TTGTATTTTCAGTTCAGACG GGG Intergenic
No off target data available for this crispr