ID: 1020677932

View in Genome Browser
Species Human (GRCh38)
Location 7:11202581-11202603
Sequence TTGCTTCGCAAGTGCAATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020677931_1020677932 -4 Left 1020677931 7:11202562-11202584 CCAAATAATGATGAAAAGATTGC No data
Right 1020677932 7:11202581-11202603 TTGCTTCGCAAGTGCAATGTCGG No data
1020677930_1020677932 9 Left 1020677930 7:11202549-11202571 CCTATGTGGGAAACCAAATAATG No data
Right 1020677932 7:11202581-11202603 TTGCTTCGCAAGTGCAATGTCGG No data
1020677927_1020677932 22 Left 1020677927 7:11202536-11202558 CCCTAGAGGACAGCCTATGTGGG No data
Right 1020677932 7:11202581-11202603 TTGCTTCGCAAGTGCAATGTCGG No data
1020677929_1020677932 21 Left 1020677929 7:11202537-11202559 CCTAGAGGACAGCCTATGTGGGA No data
Right 1020677932 7:11202581-11202603 TTGCTTCGCAAGTGCAATGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020677932 Original CRISPR TTGCTTCGCAAGTGCAATGT CGG Intergenic
No off target data available for this crispr