ID: 1020679406

View in Genome Browser
Species Human (GRCh38)
Location 7:11218609-11218631
Sequence CTCAGACATGGTTAGATCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020679406_1020679409 13 Left 1020679406 7:11218609-11218631 CCTTCGATCTAACCATGTCTGAG No data
Right 1020679409 7:11218645-11218667 GATCAGTATCTACAATTTGGAGG No data
1020679406_1020679410 14 Left 1020679406 7:11218609-11218631 CCTTCGATCTAACCATGTCTGAG No data
Right 1020679410 7:11218646-11218668 ATCAGTATCTACAATTTGGAGGG No data
1020679406_1020679408 10 Left 1020679406 7:11218609-11218631 CCTTCGATCTAACCATGTCTGAG No data
Right 1020679408 7:11218642-11218664 AAAGATCAGTATCTACAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020679406 Original CRISPR CTCAGACATGGTTAGATCGA AGG (reversed) Intergenic
No off target data available for this crispr