ID: 1020682722

View in Genome Browser
Species Human (GRCh38)
Location 7:11256778-11256800
Sequence CTGTGTTCTGGGCATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020682722_1020682726 -7 Left 1020682722 7:11256778-11256800 CCAGCATCATGCCCAGAACACAG No data
Right 1020682726 7:11256794-11256816 AACACAGAGGCTTTTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020682722 Original CRISPR CTGTGTTCTGGGCATGATGC TGG (reversed) Intergenic
No off target data available for this crispr