ID: 1020688282

View in Genome Browser
Species Human (GRCh38)
Location 7:11322909-11322931
Sequence TCTCCTGGATGGAGGCCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020688276_1020688282 3 Left 1020688276 7:11322883-11322905 CCTGGCAGTAATCCGGCACCTCT No data
Right 1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG No data
1020688278_1020688282 -9 Left 1020688278 7:11322895-11322917 CCGGCACCTCTGTCTCTCCTGGA No data
Right 1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020688282 Original CRISPR TCTCCTGGATGGAGGCCTAG AGG Intergenic
No off target data available for this crispr