ID: 1020688527

View in Genome Browser
Species Human (GRCh38)
Location 7:11326103-11326125
Sequence CAGTGCAAGTACATGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020688525_1020688527 1 Left 1020688525 7:11326079-11326101 CCAGAGCTGTGAAAATGGACAGA No data
Right 1020688527 7:11326103-11326125 CAGTGCAAGTACATGTTTCCAGG No data
1020688524_1020688527 2 Left 1020688524 7:11326078-11326100 CCCAGAGCTGTGAAAATGGACAG No data
Right 1020688527 7:11326103-11326125 CAGTGCAAGTACATGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020688527 Original CRISPR CAGTGCAAGTACATGTTTCC AGG Intergenic
No off target data available for this crispr