ID: 1020690871

View in Genome Browser
Species Human (GRCh38)
Location 7:11353239-11353261
Sequence AGTCCTCGGAGATGACCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020690868_1020690871 -5 Left 1020690868 7:11353221-11353243 CCAGGGTGCAGTCTCCAGAGTCC No data
Right 1020690871 7:11353239-11353261 AGTCCTCGGAGATGACCTGTAGG No data
1020690865_1020690871 22 Left 1020690865 7:11353194-11353216 CCACTCTTCTACATAGTCACTTA No data
Right 1020690871 7:11353239-11353261 AGTCCTCGGAGATGACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020690871 Original CRISPR AGTCCTCGGAGATGACCTGT AGG Intergenic