ID: 1020694880

View in Genome Browser
Species Human (GRCh38)
Location 7:11401304-11401326
Sequence CCTTATTTATGAAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020694875_1020694880 4 Left 1020694875 7:11401277-11401299 CCGGGAAACATTTTTGCAAAACT 0: 1
1: 0
2: 2
3: 41
4: 388
Right 1020694880 7:11401304-11401326 CCTTATTTATGAAGGGTGGCAGG No data
1020694872_1020694880 23 Left 1020694872 7:11401258-11401280 CCTTCTTGAGCTCATAAAACCGG 0: 1
1: 0
2: 0
3: 8
4: 59
Right 1020694880 7:11401304-11401326 CCTTATTTATGAAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020694880 Original CRISPR CCTTATTTATGAAGGGTGGC AGG Intronic
No off target data available for this crispr