ID: 1020700193

View in Genome Browser
Species Human (GRCh38)
Location 7:11472253-11472275
Sequence TTGACCTTGAATAAGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020700193_1020700196 -4 Left 1020700193 7:11472253-11472275 CCCCAAATCTTATTCAAGGTCAA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1020700196 7:11472272-11472294 TCAAATTAAACAGATGTGATAGG No data
1020700193_1020700198 16 Left 1020700193 7:11472253-11472275 CCCCAAATCTTATTCAAGGTCAA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1020700198 7:11472292-11472314 AGGAACTGAAGTTTGTTACCGGG 0: 1
1: 0
2: 0
3: 12
4: 137
1020700193_1020700199 19 Left 1020700193 7:11472253-11472275 CCCCAAATCTTATTCAAGGTCAA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1020700199 7:11472295-11472317 AACTGAAGTTTGTTACCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 59
1020700193_1020700197 15 Left 1020700193 7:11472253-11472275 CCCCAAATCTTATTCAAGGTCAA 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1020700197 7:11472291-11472313 TAGGAACTGAAGTTTGTTACCGG 0: 1
1: 0
2: 0
3: 15
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020700193 Original CRISPR TTGACCTTGAATAAGATTTG GGG (reversed) Intronic
900143041 1:1146462-1146484 TTGACCTTGAATGGGTTTTTTGG + Intergenic
907059801 1:51409968-51409990 TTGAGCTTAAAACAGATTTGTGG - Intronic
910818536 1:91319375-91319397 TTGAGCCTGAATAAGACTGGGGG + Exonic
912186670 1:107285031-107285053 TTGACCTATATTAAGTTTTGTGG + Intronic
913082503 1:115401729-115401751 TTGATTTTTAAAAAGATTTGAGG - Intergenic
916393549 1:164359949-164359971 TTGAACTTAAATGACATTTGCGG + Intergenic
917594433 1:176514735-176514757 TTGACTTTGAATCAAATTTTAGG + Intronic
917771308 1:178282215-178282237 TGGACCTTGAATTATCTTTGGGG + Intronic
917824099 1:178798795-178798817 TTTTTCTTGAATAATATTTGAGG - Intronic
918407446 1:184224771-184224793 TTGAACTTTAAGAAGACTTGGGG + Intergenic
918453136 1:184680235-184680257 TGGACCTTGAATTATTTTTGTGG - Intergenic
918470528 1:184868209-184868231 TTGACTTGCAATATGATTTGTGG + Intronic
918822345 1:189270913-189270935 TTGATCTTGAAAAAAATCTGAGG + Intergenic
920652450 1:207848955-207848977 GGGACTTTGAATAAGTTTTGTGG + Intergenic
920688857 1:208130635-208130657 TTGACCTTGACTCAGATGTGTGG + Intronic
921603274 1:217130175-217130197 TTGATCTTGAATATCATTTTTGG + Intronic
924372352 1:243364701-243364723 TTGAACTGGAAAAACATTTGAGG + Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1063813474 10:9742210-9742232 TTGACCTTGTATATGATACGTGG - Intergenic
1065645243 10:27826977-27826999 ATGGCCTTGAATAAGAAGTGAGG - Intronic
1068048627 10:51919636-51919658 TTGACCTTAAAGAACATTTTTGG - Intronic
1068524617 10:58114014-58114036 TTGTGTTTGAATAAGACTTGGGG - Intergenic
1076385886 10:130055348-130055370 TTGACCTTTTATCAGATATGTGG - Intergenic
1079762190 11:24342912-24342934 ATGACCTCTAATAAAATTTGTGG + Intergenic
1085987379 11:81802864-81802886 ATGACTTTGAATAGAATTTGAGG + Intergenic
1086141122 11:83501597-83501619 TTGACCTTGAATGAGGTTTCAGG - Intronic
1087783118 11:102322063-102322085 TTGATTTTGAATTTGATTTGTGG + Exonic
1087923096 11:103889572-103889594 TTTACTCTGACTAAGATTTGTGG + Intergenic
1088778643 11:113112133-113112155 TTGACCTTGAATTAGATGTAGGG + Intronic
1089043495 11:115477295-115477317 TATACCTTGGATAAGATTTAAGG - Intronic
1090990208 11:131810362-131810384 GTGACATTGAATCTGATTTGTGG + Intronic
1092295363 12:7192952-7192974 CTCACCTTTAATAAGATCTGTGG + Intronic
1094210452 12:27884927-27884949 TTGACATTGACAAAGATTGGAGG + Intergenic
1096023103 12:48338463-48338485 TTGACCTTGGAGAAGACCTGTGG + Exonic
1098259303 12:68651790-68651812 TTGAACTTGATTACAATTTGGGG + Intronic
1099172090 12:79376927-79376949 TTGCCCTAGAATAAGAGTTCTGG - Intronic
1099891250 12:88591494-88591516 TTGATCTTAAAAAAGATTTGTGG + Intergenic
1099921768 12:88967012-88967034 TTGACCTTGAATCTGATATTAGG + Intergenic
1100076061 12:90785368-90785390 TTGACCTTGAATAGAAGTTGGGG - Intergenic
1100533286 12:95480273-95480295 TTTACATTGAACAATATTTGGGG + Intronic
1100575145 12:95884049-95884071 TTGATGTTGAATAAGAGTAGAGG - Intronic
1101665002 12:106804774-106804796 CTGACCTTGAATTATATTTATGG - Intronic
1106741672 13:32650197-32650219 TGGACCTTGAACAAACTTTGTGG + Intronic
1107130550 13:36889872-36889894 TTGATGTTGCATAAGATCTGGGG - Intronic
1110242905 13:73288561-73288583 TTGGCCTGGAAAAAAATTTGAGG - Intergenic
1110275156 13:73634468-73634490 ATGGCCTTAAATAACATTTGAGG - Intergenic
1111327233 13:86714830-86714852 ATCAGCTTGAATAATATTTGGGG - Intergenic
1111501533 13:89127905-89127927 TTGAACTTGAAAGAGATTTAGGG - Intergenic
1114072536 14:19126258-19126280 ATGGCCTTGGATAAGATCTGGGG + Intergenic
1114089721 14:19273717-19273739 ATGGCCTTGGATAAGATCTGGGG - Intergenic
1115503051 14:34066073-34066095 TTGACATTTACTTAGATTTGGGG - Intronic
1117205837 14:53442896-53442918 TTGACCCTGAGGAAAATTTGGGG + Intergenic
1117242152 14:53844896-53844918 TAGGCCTTGAATCAGATTTCTGG - Intergenic
1117548802 14:56813479-56813501 CTGACCTAGAATAGGGTTTGTGG - Intergenic
1118523017 14:66608241-66608263 TTGCTCTTGAATAAGTTTTGGGG - Intronic
1120897763 14:89549583-89549605 TTGGACTAGTATAAGATTTGGGG - Intronic
1124171535 15:27377916-27377938 TTGTGCTAGAACAAGATTTGGGG + Intronic
1126348529 15:47720356-47720378 TTGAGTTTGATTTAGATTTGTGG + Intronic
1127630646 15:60824330-60824352 TTGTTCTTGGATATGATTTGGGG + Intronic
1127648507 15:60982992-60983014 TAGACCTTGAAGAAGACTGGCGG + Intronic
1127734604 15:61829388-61829410 ATGACATTGAGAAAGATTTGTGG - Intergenic
1131648301 15:94370415-94370437 TTGAGCTTCAAAAACATTTGTGG + Intronic
1132002638 15:98195413-98195435 TTGGCCTGGAATAAGCTTTCTGG - Intergenic
1132051982 15:98614989-98615011 TTGGCCTTGAATACGAGTAGCGG + Intergenic
1134322688 16:13178112-13178134 TTGAACTTGAAGAACACTTGTGG + Intronic
1134332234 16:13261565-13261587 TTGACTAGGAATAAAATTTGGGG + Intergenic
1139333137 16:66209846-66209868 TTGACCGTGAATGAGGTTTTGGG + Intergenic
1140871513 16:79110939-79110961 TTGACCATGAAGAAGAATTAAGG - Intronic
1144594144 17:16552393-16552415 TTGATGTTGAATAAGGGTTGAGG + Exonic
1150873337 17:68940488-68940510 TTGATCTGGTATAGGATTTGAGG - Intronic
1151065595 17:71145961-71145983 TTGACTTTGAGTATCATTTGAGG - Intergenic
1153963314 18:10158441-10158463 TGCACCTTGAATAGGATCTGGGG + Intergenic
1158274968 18:55757190-55757212 CTGACTTTGAATAAGAATTCAGG + Intergenic
1158657137 18:59347933-59347955 TTGTCCATGAAGGAGATTTGTGG - Intronic
1162387571 19:10369118-10369140 TAAACCTTGATTAAGATTTGGGG + Intronic
1164108355 19:22130229-22130251 TTTACGTTCAATAAGGTTTGAGG + Intergenic
1164304285 19:23990454-23990476 TTGGCATTGAATAACACTTGTGG + Intergenic
926370795 2:12176953-12176975 TTGATTTCTAATAAGATTTGGGG - Intergenic
928749643 2:34457125-34457147 TGGACCTTGAGTAACATTGGTGG - Intergenic
928791621 2:34963008-34963030 TTGATCCTGGATAAGATTTCAGG - Intergenic
935663507 2:105489528-105489550 TTAAACTTGATTAAGTTTTGAGG + Intergenic
936484559 2:112915099-112915121 GTGGCCTTGAGAAAGATTTGGGG + Intronic
937161447 2:119766153-119766175 TTGGCTTTGAATAGCATTTGTGG + Intronic
939483922 2:142784742-142784764 TTGTCATTGAACAAGGTTTGTGG + Intergenic
940688939 2:156890325-156890347 TTGACATTTTATAAGATTTGGGG - Intergenic
941536787 2:166732608-166732630 TTGACCTTAAATAGGATTCTAGG + Intergenic
942438492 2:176006154-176006176 ATAACATTGAAAAAGATTTGGGG - Intergenic
943328908 2:186535557-186535579 ATGGCCCTGAGTAAGATTTGAGG + Intergenic
943828246 2:192424564-192424586 TTTACCTTGAAAAAGATTTAAGG - Intergenic
944696473 2:202205038-202205060 GGGACCTTGAATAACATTTAGGG - Intergenic
947561291 2:231154818-231154840 TTGACATTGAATCATTTTTGAGG + Intronic
1169716183 20:8621127-8621149 TTGACCTTGGATGAAAGTTGAGG + Intronic
1169828443 20:9795586-9795608 TAGATGTTGAATAAAATTTGTGG + Intronic
1170377712 20:15718838-15718860 GTGACCTTGGATAAGATTGTTGG + Intronic
1174764970 20:53244979-53245001 TTGGCTTGGAATAAGATTTAGGG + Intronic
1179820070 21:43931549-43931571 TTAACCTTGAAAAAGAGATGTGG + Intronic
1180490983 22:15848630-15848652 ATGGCCTTGGATAAGATCTGGGG + Intergenic
1183132528 22:35852901-35852923 TAGGCCTTCAATAACATTTGGGG - Intronic
1185092447 22:48783507-48783529 TTGACCTTGGAGATGGTTTGGGG - Intronic
950069119 3:10137817-10137839 TTGACCATGAAGGAGTTTTGGGG + Intergenic
951115769 3:18860134-18860156 TTGGGGTTGGATAAGATTTGGGG + Intergenic
952092520 3:29906429-29906451 TTGCCATGGAATTAGATTTGTGG - Intronic
954741230 3:52752373-52752395 TTGATTTTGTATAAGATATGAGG - Intronic
955114949 3:55988711-55988733 TTGAACTTGAAATAGATTTGTGG - Intronic
955271932 3:57508897-57508919 TTAGCCTTGAGTAAGCTTTGGGG - Intronic
955355847 3:58232003-58232025 TGGACCTTTAATAAGAGGTGAGG - Intergenic
956751091 3:72344431-72344453 TTGCCTTTGAGCAAGATTTGAGG + Intergenic
958485654 3:94704174-94704196 TTGTCCTTGAAAAAGATACGTGG - Intergenic
960500819 3:118436335-118436357 TTGGCCTTGAACAAGAGTTCTGG - Intergenic
961185749 3:124913774-124913796 TTGCCTTTTAATAAGTTTTGGGG + Intronic
961331641 3:126146085-126146107 TTGACCATGCATATGAGTTGGGG - Intronic
963383788 3:144565092-144565114 TTTACCCTGAATAAAATTTGAGG + Intergenic
964097386 3:152948604-152948626 TTTACCTGGATTAAGATTTAAGG - Intergenic
964542508 3:157795252-157795274 TGGACCTTAATTAAAATTTGTGG + Intergenic
964795573 3:160493114-160493136 TTAATCTTGAACAAGAGTTGTGG + Intergenic
965710238 3:171549585-171549607 TTGTGCTTAAATAAAATTTGGGG - Intergenic
969608402 4:8213588-8213610 CAGACCTTGAATAAGAAATGGGG + Intronic
970000782 4:11364083-11364105 TTGAGCTTGAATTGCATTTGGGG - Intergenic
971784817 4:31086526-31086548 TTTGCCTTATATAAGATTTGAGG + Intronic
976269691 4:83218466-83218488 TAGACCTTATGTAAGATTTGAGG + Intergenic
976814931 4:89137456-89137478 TTGAATTTGAATAAAATTTACGG - Intergenic
978243681 4:106547614-106547636 TTGATCAAGAATAAAATTTGTGG - Intergenic
979063049 4:116091126-116091148 TTGACATTCAATAAAATTTTAGG + Intergenic
979271023 4:118761647-118761669 TTGAATTTGAATATGTTTTGAGG + Intronic
980034801 4:127871545-127871567 TAGGACTTGAATAAGTTTTGGGG + Intergenic
980513608 4:133824877-133824899 TTGAACTTGAAGATGATTTAAGG + Intergenic
980782350 4:137508029-137508051 TTTACCTTTAATGGGATTTGGGG - Intergenic
982525303 4:156470485-156470507 TTGACCTTCAATAATATCTCAGG - Intergenic
983540483 4:168904120-168904142 TAGACCCTTAATAATATTTGTGG - Intronic
986810577 5:11353989-11354011 TTTACCTTGAGTAAGATGAGGGG + Intronic
990543771 5:56801677-56801699 TCTACCTTGAAGAAGAGTTGTGG + Intergenic
991443983 5:66680522-66680544 TTGCCCTAAAATAAGATCTGTGG - Intronic
991470647 5:66965539-66965561 TGGACCTTGAAAAATATTGGAGG + Intronic
991615319 5:68491168-68491190 TTGACCCTGAATTATAGTTGAGG + Intergenic
991653113 5:68876284-68876306 TTTGCCTTGAATTCGATTTGAGG - Intergenic
992373236 5:76166780-76166802 GTGACATTGAATGAGGTTTGTGG - Intronic
998056258 5:139080577-139080599 TAGACCCTGAACAAAATTTGAGG - Intronic
1000059453 5:157640601-157640623 ATTCCCTTGAGTAAGATTTGTGG - Intronic
1003245515 6:4378889-4378911 TTGATATTGGATCAGATTTGGGG - Intergenic
1005839073 6:29728725-29728747 TTCACCTGGTCTAAGATTTGAGG - Intronic
1006746497 6:36346511-36346533 TTGACCTTGGATTATTTTTGGGG + Intergenic
1007323815 6:41045333-41045355 CTGACCTTGTTAAAGATTTGAGG - Intronic
1008884105 6:56412608-56412630 TAACCCTTGAAAAAGATTTGTGG + Intergenic
1008894450 6:56536698-56536720 GTGACCATGAATCATATTTGTGG - Intronic
1009370461 6:62894197-62894219 TTCACCTAGAAGAAAATTTGAGG + Intergenic
1010531619 6:76975058-76975080 TTCACTTAGAATAAGATTTTCGG + Intergenic
1010986061 6:82425711-82425733 TTGACCTTTAATAAGTCTTAAGG - Intergenic
1014105799 6:117559148-117559170 GTGACCATGAGTGAGATTTGAGG - Intronic
1014455284 6:121626301-121626323 CTGGCCTTGATTAAGATTTAGGG + Intergenic
1015314716 6:131805810-131805832 TTGTCCTTGAATCTGATTTTTGG + Intergenic
1015829636 6:137354250-137354272 GTGACTTTGATTAAGAGTTGTGG + Intergenic
1016345309 6:143106686-143106708 TTGACCTTGGGTTAGGTTTGGGG + Intronic
1016518312 6:144921954-144921976 TTATCCTTGATTAATATTTGGGG + Intergenic
1016879397 6:148896115-148896137 GTGACCTTGGAGAAGATTTCTGG + Intronic
1020700193 7:11472253-11472275 TTGACCTTGAATAAGATTTGGGG - Intronic
1022616350 7:31934742-31934764 CTGACCTTGAGTAAAATTTCTGG - Intronic
1034722077 7:153302646-153302668 TTGACCTTGAATGCAATTTAGGG + Intergenic
1036675891 8:10832937-10832959 TTGAACTTTAATATGATCTGTGG + Exonic
1037706086 8:21316337-21316359 TTGGCCTGGAATTAGAGTTGTGG - Intergenic
1037736054 8:21567043-21567065 TTGAGCTTGAAGAAGATAGGGGG + Intergenic
1039734121 8:40311843-40311865 TTAACCTTGAATTAACTTTGAGG + Intergenic
1039743541 8:40403529-40403551 TAGAACATGAAGAAGATTTGGGG - Intergenic
1040696185 8:50001770-50001792 TTAACCTTGAACAAGCTATGAGG - Intronic
1041360979 8:57053814-57053836 TTGACCTGGAATAAGACATTTGG + Intergenic
1042333932 8:67610777-67610799 TTGAGCTTGATAAAGATTTCAGG + Intronic
1044688275 8:94850148-94850170 TTAACCTTGAAATATATTTGAGG + Intronic
1046587768 8:116168536-116168558 ATGACCTTGAATAAAATATCAGG + Intergenic
1046827870 8:118711642-118711664 TTGAGCTTAAATAAGACTAGAGG - Intergenic
1046897315 8:119486579-119486601 TTCACCTTGCCTAAGCTTTGGGG + Intergenic
1046997874 8:120544288-120544310 TTGACCTCAAATAGTATTTGGGG + Intronic
1047001118 8:120573442-120573464 TTAACCTTTAATTAGATATGAGG + Intronic
1047120997 8:121905013-121905035 TGGACATTGAGTAAGATTAGGGG - Intergenic
1049131785 8:140851548-140851570 TTTACTTTTAATAAAATTTGGGG - Intronic
1050895458 9:10880536-10880558 TTGATATTGCATAAAATTTGAGG + Intergenic
1051930651 9:22381226-22381248 TCAACCTTCAATTAGATTTGAGG - Intergenic
1052248812 9:26372508-26372530 TTTACCTTTAATAAGATTAGTGG - Intergenic
1054990682 9:71322186-71322208 ATGACATTTAATATGATTTGAGG + Intronic
1055895865 9:81174829-81174851 TTATCCTAGAATAAGAATTGTGG - Intergenic
1057587970 9:96346627-96346649 TTGACATTGAAGAAGATTCAGGG - Intronic
1059927319 9:119223121-119223143 TTGACCTTGAAGAAGCTAAGAGG + Intronic
1060385717 9:123226416-123226438 GTGACCTTGAGGAAGATTTCTGG - Intronic
1060442726 9:123656511-123656533 TTGACGATGAATTAGACTTGGGG + Intronic
1060456482 9:123803419-123803441 TTGAGGTTGGAGAAGATTTGAGG - Intronic
1185739998 X:2524015-2524037 GTGACCTTGAATAAAATGAGAGG - Intergenic
1189664356 X:43337510-43337532 TTGACCTTAAACTAAATTTGAGG + Intergenic
1192751635 X:73998276-73998298 TTTCCCTTGAAAGAGATTTGAGG + Intergenic
1193192735 X:78592055-78592077 ATGGCCTTGGACAAGATTTGGGG + Intergenic
1195267939 X:103201672-103201694 ATGTCCATGAATAAGAGTTGTGG + Intergenic
1196128522 X:112126125-112126147 TTAACCTTGAACAAAATATGGGG + Intergenic
1196823281 X:119720914-119720936 CTGAGCTGGAATAGGATTTGTGG + Intergenic
1198468897 X:136928179-136928201 TTGTCCTTGAAAATCATTTGTGG + Intergenic
1199247122 X:145618398-145618420 TTGAACTTTAATTAGATTTAGGG + Intergenic
1200417801 Y:2931070-2931092 CTGATCTTGGACAAGATTTGGGG - Intronic