ID: 1020702362

View in Genome Browser
Species Human (GRCh38)
Location 7:11499183-11499205
Sequence TGGGATCCACACACCCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020702356_1020702362 7 Left 1020702356 7:11499153-11499175 CCCAAGGAGAGGCGGTCAGTCCA 0: 1
1: 0
2: 32
3: 55
4: 142
Right 1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG 0: 1
1: 0
2: 2
3: 20
4: 137
1020702357_1020702362 6 Left 1020702357 7:11499154-11499176 CCAAGGAGAGGCGGTCAGTCCAA 0: 1
1: 0
2: 0
3: 43
4: 187
Right 1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG 0: 1
1: 0
2: 2
3: 20
4: 137
1020702352_1020702362 25 Left 1020702352 7:11499135-11499157 CCAACAAGCTGCAGTTGACCCAA 0: 16
1: 46
2: 63
3: 81
4: 160
Right 1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG 0: 1
1: 0
2: 2
3: 20
4: 137
1020702351_1020702362 28 Left 1020702351 7:11499132-11499154 CCTCCAACAAGCTGCAGTTGACC 0: 13
1: 50
2: 71
3: 92
4: 407
Right 1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG 0: 1
1: 0
2: 2
3: 20
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020702362 Original CRISPR TGGGATCCACACACCCTTCA TGG Intronic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
902702967 1:18185230-18185252 TGGGATCCACAGACCTATCTAGG + Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
907041131 1:51261208-51261230 TGAGATCCACAGACCCTTTAAGG + Intronic
913242243 1:116839145-116839167 GGGGTACCACACCCCCTTCACGG + Intergenic
916118239 1:161506274-161506296 TGGCATCCACAGTCCCTTCAGGG + Intronic
920557742 1:206916363-206916385 TGGCATTCACACCCCCTTCCTGG - Intronic
920597195 1:207283933-207283955 TGGTTTCCACACAACCATCAGGG - Intergenic
920843633 1:209575675-209575697 TGGGAGCCAGACAGCCTTCTGGG - Intergenic
1063593567 10:7412910-7412932 TGGGCTCCAGACACTCTCCACGG + Intergenic
1066501499 10:35999576-35999598 AGGGCTCCAGAGACCCTTCAGGG - Intergenic
1069971444 10:72173685-72173707 TTGGAACCAAACAACCTTCAAGG + Intronic
1070761636 10:79027774-79027796 TGTGGTCCACACACCCACCACGG + Intergenic
1071391706 10:85181778-85181800 TGGAATCCACAAATCATTCAGGG + Intergenic
1072685593 10:97534789-97534811 TGGGAGGCACACAGCCTCCAAGG + Intronic
1074893838 10:117757722-117757744 TGGCATCCCCACACCCTGCCTGG + Intergenic
1074971686 10:118544326-118544348 CTGGATCCACACACGCTCCAGGG + Intergenic
1076120953 10:127936018-127936040 TGGGATGCACTCTCCTTTCACGG + Intronic
1076801701 10:132833957-132833979 TGGGATCCACCCACCCATCCGGG - Intronic
1080701657 11:34649472-34649494 TGTGAAACACACACCCATCAAGG - Intronic
1084006817 11:66327345-66327367 TGGGGTCACCACACCCCTCATGG + Intergenic
1084139087 11:67211828-67211850 TGTGATCTTCACAACCTTCAGGG + Intronic
1085198129 11:74684319-74684341 TGGGATCCTTACACCCTTGAGGG + Intergenic
1091308683 11:134557779-134557801 TGGGCTCCACACACCCCTGCTGG - Intergenic
1091316826 11:134620095-134620117 TGGGATCCTTGCAGCCTTCAGGG + Intergenic
1091954434 12:4626636-4626658 TGGGTGCTGCACACCCTTCAGGG + Exonic
1093737261 12:22635323-22635345 TGGTCTACACACACCCTTCTTGG - Intronic
1095967309 12:47877721-47877743 TGAGGTCCACACATCCTGCAGGG - Intronic
1096193579 12:49634957-49634979 TGGGATCTGAACACCATTCATGG - Intronic
1098312095 12:69158631-69158653 TTGGATAGACACACCTTTCAAGG - Intergenic
1108001849 13:45911208-45911230 TGGGATCCTCAGCCCATTCAAGG - Intergenic
1108434589 13:50389462-50389484 TGGGATGACCACACCCTTCCTGG + Intronic
1114170014 14:20262790-20262812 TGGGATCCACTCACTTTTAATGG - Intronic
1114323297 14:21565048-21565070 CTGGATCCACACTCCCTTCAGGG - Intergenic
1117754428 14:58959113-58959135 TGGGCTCTTCATACCCTTCAAGG + Intergenic
1122786324 14:104165929-104165951 TGGGTTTAACACACCCTCCAGGG - Intronic
1124366994 15:29079197-29079219 TGGGTTCCACATGCCCTTCTTGG + Intronic
1128421223 15:67493080-67493102 TGCTATTCACACATCCTTCAGGG + Intronic
1129262336 15:74375468-74375490 TGGGTTCCTCACACCCTCCACGG - Intergenic
1132396139 15:101475912-101475934 TGGGGCCCACACACACTTCTGGG + Intronic
1138294519 16:55874911-55874933 TGGGTTGCTCACACCCTGCAAGG - Intronic
1138559464 16:57792055-57792077 TGGGAAACACATACCCTTCAAGG - Intronic
1138607107 16:58096574-58096596 TGGGATCCTTTCACCCTGCAAGG - Intergenic
1139215794 16:65123171-65123193 GGGGATCCGCACACCCAGCAGGG + Intronic
1140207534 16:72946027-72946049 TGGGATTCACACTCCCAGCAGGG - Intronic
1141598749 16:85112748-85112770 TGGGCTCCTCCCTCCCTTCAGGG + Intergenic
1143434496 17:6913868-6913890 TGGGATACACACCCCCACCAGGG + Intronic
1144465789 17:15496208-15496230 AGAGTCCCACACACCCTTCAGGG + Intronic
1146432122 17:32807623-32807645 TGGGATACACACACACTTCTGGG + Intronic
1147310797 17:39595262-39595284 TGGGATTCCCCCACCCTGCATGG + Intergenic
1147981623 17:44278346-44278368 AGGGTTCCACCCATCCTTCAAGG - Intergenic
1150030548 17:61729860-61729882 TGGGATCTAGACACCCCCCACGG - Intronic
1151672265 17:75577696-75577718 TGGGATCCCCACAGCCATCCAGG + Intergenic
1156503507 18:37574797-37574819 TGTGATCCACACATCATTAAAGG + Intergenic
1159079486 18:63721458-63721480 TTGGATCCAAACTCCTTTCACGG - Intronic
1159888443 18:73932839-73932861 TGGGGTCCATGCAGCCTTCAGGG - Intergenic
1160969808 19:1762556-1762578 TGGGATCCACACACCCGCCAAGG - Intronic
1162432041 19:10634925-10634947 TGGGCTCCCCACTCCCTCCAAGG - Intronic
1164841746 19:31398001-31398023 TGGCACCCAGACACCCATCAGGG - Intergenic
1165894003 19:39130769-39130791 TGGAATCCACACACCCCACCTGG - Intronic
1168133065 19:54332956-54332978 TGGTATAAACACTCCCTTCATGG - Intergenic
1168175629 19:54625537-54625559 TGGGATCCACACCCCTGTCTTGG - Intronic
925254183 2:2468208-2468230 TGAGGTCCATACACCCCTCAAGG + Intergenic
925701718 2:6645632-6645654 TCAGATCCACACACCCATCCTGG - Intergenic
926974259 2:18497456-18497478 TGGAATATAGACACCCTTCATGG + Intergenic
928237649 2:29558584-29558606 TGGAATCTGCTCACCCTTCAAGG + Intronic
928459539 2:31457797-31457819 TCGCATTCACTCACCCTTCAGGG + Intergenic
929628576 2:43435058-43435080 GGGGACTCACACACCCTGCAAGG + Intronic
929646940 2:43637427-43637449 TGGGATCCCCGCCCCCTTGAGGG + Intronic
932655885 2:73610925-73610947 TGGCATCCAGACACCTTCCAAGG + Intergenic
933131697 2:78681050-78681072 TGGGATACACACCCCCACCAGGG + Intergenic
933833332 2:86227475-86227497 TGGGATCCCCACACCTCTCCAGG - Intronic
933909552 2:86927823-86927845 TGGGATCCCCACATCCTTCGGGG - Intronic
934023173 2:87975556-87975578 TGGGATCCCCACATCCTTCGGGG + Intergenic
935349773 2:102142986-102143008 TGGGATCCCATCACCCTCCACGG + Exonic
935979507 2:108613021-108613043 TTGGATCCACACACTCTTATTGG + Intronic
936413382 2:112280849-112280871 TGGGATCCCCACATCCTTCAGGG - Intronic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
939535750 2:143426017-143426039 TGTGAGCCACACACTCTGCAAGG + Intronic
940366372 2:152852658-152852680 TGGGATACACACCCCCACCAGGG - Intergenic
1169685903 20:8271350-8271372 AGGTATGTACACACCCTTCATGG - Intronic
1170765498 20:19286407-19286429 TGGGATCCTGACACTGTTCATGG - Intronic
1170803712 20:19611733-19611755 TGGGACCAACAGACCCTTCAAGG - Intronic
1171145590 20:22778712-22778734 TGGGATCCTGTCACCCATCAAGG + Intergenic
1171190652 20:23156848-23156870 TGGTCTCCATACACCTTTCAGGG - Intergenic
1172853250 20:37981799-37981821 TGGAATCCACACACTCATTAGGG - Intergenic
1175797453 20:61780832-61780854 TGAGATCCACTCACCCTTTGAGG - Intronic
1176188161 20:63792938-63792960 TGGGAACCCCACACCATCCAAGG - Intronic
1176371640 21:6065939-6065961 TGGGCCCCACACACCTCTCATGG + Intergenic
1176388745 21:6152610-6152632 AGGGACCCACACACACTCCAGGG + Intergenic
1177355227 21:19998593-19998615 TGGAATCCAAACACCCCTGAGGG - Intergenic
1178423447 21:32460188-32460210 TGGTGTCCACACCCCCTCCAGGG + Intronic
1179734727 21:43385638-43385660 AGGGACCCACACACACTCCAGGG - Intergenic
1179751879 21:43472600-43472622 TGGGCCCCACACACCTCTCATGG - Intergenic
1180656225 22:17423240-17423262 TGTTATCCCCCCACCCTTCATGG + Intronic
1181058960 22:20272885-20272907 AAGGATCCACACTCCCTGCAGGG - Intronic
1181268247 22:21643330-21643352 GGGAATCCACACAGCCTTGAGGG + Intronic
1182321856 22:29482789-29482811 TGGGATCCAAAAACCCTGCAGGG - Intronic
1184736725 22:46402684-46402706 TGGGAACCACAAAACTTTCAAGG + Intronic
955471188 3:59288037-59288059 TAGAATCCAAACTCCCTTCATGG + Intergenic
956160361 3:66345279-66345301 TGGGAAGCTCGCACCCTTCAAGG - Intronic
958491399 3:94778550-94778572 TGGGATCCCCACACACACCAAGG - Intergenic
958677075 3:97278799-97278821 TGGCCTGCACACACCCCTCATGG + Intronic
964192385 3:154018297-154018319 TGAGATCCACACTCCCTTGTTGG - Intergenic
966681319 3:182644661-182644683 GGGGATCCACAAAGCCTTCCTGG - Intergenic
968705240 4:2074611-2074633 TGGGAGCCTCACACCCCTAAGGG + Intronic
975321083 4:73011201-73011223 TGGGCGCCACACCCACTTCAAGG + Intergenic
978727564 4:111987337-111987359 TGAGATCCTCTCAACCTTCATGG - Intergenic
983953000 4:173663815-173663837 TGGTAGGCACACACCCTTCTAGG + Intergenic
984548800 4:181136687-181136709 TGGGTTCCATACACCTATCATGG + Intergenic
985547342 5:516258-516280 TGGGATCCCCACTGCCTACAGGG + Intronic
985793792 5:1947204-1947226 AGGGGACCATACACCCTTCAGGG - Intergenic
985817188 5:2135703-2135725 TGGGCTCCACACTCCCCACAAGG - Intergenic
989548367 5:42701077-42701099 TGGGAGCCACAGACCCTTGAGGG + Intronic
990712305 5:58598636-58598658 TGTGATCCAGACACACTACAAGG - Intronic
991410676 5:66342426-66342448 TGGGATCCAAGCCCACTTCAGGG - Intergenic
991714880 5:69442363-69442385 TGGGATTCAAACACCTTTCAAGG - Intronic
992334208 5:75748801-75748823 TGGAATCCTCACACCCATCAAGG - Intergenic
993628074 5:90250041-90250063 TGGGAGCCACACAACAGTCATGG + Intergenic
994682045 5:102900161-102900183 TGTGATCCTATCACCCTTCAAGG - Intronic
998977528 5:147664536-147664558 TGGGATCCTCACATTCCTCATGG + Intronic
1000042789 5:157497708-157497730 TGGGATCCTCACAGCTTCCATGG + Intronic
1007680054 6:43627793-43627815 TGGGAGCCAGACAGCCTTGAAGG - Intronic
1007691697 6:43706510-43706532 TGGGAGCCACAGATCCTTTATGG + Intergenic
1008521359 6:52364329-52364351 AGGTATACACACACCCTTAATGG - Intronic
1011438465 6:87363255-87363277 TGTGGTCCAGAGACCCTTCAAGG + Intronic
1014676819 6:124378003-124378025 TGGTATCCACACAGCCAGCAGGG - Intronic
1014913868 6:127121125-127121147 TGGGAGCCACACACTTGTCAAGG + Intronic
1018444322 6:163841489-163841511 TGGGGTCATCACACCCTCCAGGG - Intergenic
1018444362 6:163841743-163841765 TGGGGTCATCACACCCTCCAGGG - Intergenic
1018444374 6:163841815-163841837 TGGGGTCATCACACCCTCCAGGG - Intergenic
1019525077 7:1477175-1477197 TGGGCTCCCCACATCCTCCAGGG - Intronic
1020333929 7:7047019-7047041 CGGGATCCACTCAGCCTTAATGG - Intergenic
1020485352 7:8714313-8714335 TGGGACTGACTCACCCTTCAGGG + Intronic
1020702362 7:11499183-11499205 TGGGATCCACACACCCTTCATGG + Intronic
1028841433 7:95433789-95433811 TGTGTTGCACCCACCCTTCAAGG + Intronic
1031149641 7:118038362-118038384 TGAGCTCCCTACACCCTTCAAGG - Intergenic
1034978463 7:155461164-155461186 TGGGGGCCCCCCACCCTTCAGGG - Intronic
1036523323 8:9512529-9512551 TGGATTCCACACACTCTTCAAGG - Intergenic
1037324101 8:17671519-17671541 TCTGAGCCACACTCCCTTCATGG - Intronic
1038093197 8:24277784-24277806 TGGGATCCATAAATCCTTCATGG - Intergenic
1039602556 8:38852795-38852817 GGGGCTCCTCACACACTTCATGG - Exonic
1039623984 8:39028715-39028737 TTAGATCGACTCACCCTTCAAGG + Intronic
1042321609 8:67481527-67481549 GGGGATCCACAGATTCTTCATGG + Intronic
1042401564 8:68354705-68354727 TGGTAATCACACACCCTTGATGG - Intronic
1049860548 8:144895345-144895367 TGTGACACACATACCCTTCATGG - Intronic
1051448439 9:17167410-17167432 TGAGATCCACACACAATTCAAGG + Intronic
1056077434 9:83055818-83055840 TGGGAGCCATAGACCCTTCGGGG - Intronic
1056127846 9:83554553-83554575 TGGGTCCCACACACCCTCCATGG - Intergenic
1057304320 9:93903544-93903566 TGGGCTCCACACTCCCATCTTGG - Intergenic
1058275551 9:103037524-103037546 TGGGATACACACCCCCACCAGGG + Intergenic
1058758823 9:108109790-108109812 TGAAATCCACTCATCCTTCAGGG - Intergenic
1060725999 9:126006340-126006362 AGGAATCCAAACAGCCTTCATGG - Intergenic
1060968325 9:127723991-127724013 TGGGATCCCCACTGCCTCCATGG + Intronic
1062153209 9:135032091-135032113 TTGGATACAAACACCCTTTAAGG - Intergenic
1062316177 9:135968192-135968214 TCTGATCCACAAACCCTGCAGGG + Intergenic
1185603323 X:1353966-1353988 TGGGACCCCCACCCCCATCATGG + Intronic
1186962365 X:14750373-14750395 TGGGATCCAGACTCCCTCAATGG + Intergenic
1196186740 X:112752091-112752113 AGAGATCCAGACAGCCTTCATGG - Intergenic
1200272574 X:154699536-154699558 TGGGAACCACAGACCAGTCATGG + Intronic