ID: 1020705329

View in Genome Browser
Species Human (GRCh38)
Location 7:11537096-11537118
Sequence GTTAGCACTAGGAGGAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020705329_1020705335 15 Left 1020705329 7:11537096-11537118 CCCATATTCCTCCTAGTGCTAAC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1020705335 7:11537134-11537156 AAGTATGACAAGAACTACTTGGG 0: 1
1: 0
2: 2
3: 12
4: 189
1020705329_1020705334 14 Left 1020705329 7:11537096-11537118 CCCATATTCCTCCTAGTGCTAAC 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1020705334 7:11537133-11537155 GAAGTATGACAAGAACTACTTGG 0: 1
1: 0
2: 2
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020705329 Original CRISPR GTTAGCACTAGGAGGAATAT GGG (reversed) Intronic
904164043 1:28541954-28541976 ATTAACACCAGGAGGATTATTGG + Intergenic
907711334 1:56885023-56885045 ATTAGCACTAGGAGAAGTGTGGG + Intronic
909828885 1:80160443-80160465 GTTATCCCCAGGAGCAATATGGG + Intergenic
910284177 1:85535338-85535360 TTTATGACTGGGAGGAATATTGG - Intronic
911640282 1:100281056-100281078 GTTATCACCAGAAGGAACATTGG + Intronic
912346677 1:108969363-108969385 GTTATCCCCAGGAGCAATATGGG - Intergenic
912545947 1:110451829-110451851 GTTAGTTCTGAGAGGAATATGGG + Intronic
913373847 1:118130138-118130160 GTTAGCTCTAGGAGGCATACAGG + Intronic
914205846 1:145527647-145527669 TTTATGACTGGGAGGAATATTGG + Intergenic
915101976 1:153507317-153507339 GGAAGCACCAGGAGGAAGATGGG - Intergenic
917935817 1:179866015-179866037 GTTGGCACTAGGAAGAATTCTGG + Intronic
920527307 1:206676708-206676730 GTTAGCACCAGCAAGAAGATAGG + Intronic
921285970 1:213609620-213609642 GTGTGCACTAGGAGGAAAATGGG + Intergenic
923063752 1:230499654-230499676 GTGAGCACTGGGAGGAACACGGG + Intergenic
924512146 1:244736474-244736496 GTTACCTCCAGGAGGAATCTGGG + Intergenic
924868110 1:248008240-248008262 GGTGTCACTAGGAGGTATATGGG - Intronic
1064626827 10:17270028-17270050 GTAAGTACAAGAAGGAATATAGG - Intergenic
1066982553 10:42431840-42431862 GATAGCATTAGGAGAAATACCGG - Intergenic
1070765476 10:79053795-79053817 GTTAGCAGCAGGAGGAATTAAGG - Intergenic
1073362673 10:102912656-102912678 TTTAGCAAAAGGAGGAAAATGGG + Intergenic
1075176177 10:120163210-120163232 GTTAGAATTAGAAGGAATTTAGG - Intergenic
1077090338 11:775509-775531 GTTAGCACTAGGATGAGGCTGGG - Intronic
1077250660 11:1559276-1559298 ATTAGCATGAGGAGGAATGTGGG - Intronic
1078361365 11:10670603-10670625 ATAAGAACTAGGAGGAGTATTGG - Intronic
1080880623 11:36316701-36316723 GTTATCCCTAGGAGCAATTTGGG + Intronic
1081075831 11:38672510-38672532 GTTATCCCTAGGAGCAATTTAGG - Intergenic
1088126126 11:106425731-106425753 TTTAGCAATGGGAAGAATATGGG + Intergenic
1089106870 11:116016548-116016570 GTTAGTAACAGGAGGAATTTTGG - Intergenic
1089395533 11:118134412-118134434 ATTTGCACTAGGATGTATATGGG - Exonic
1092062039 12:5559311-5559333 TTTTCCACTAGAAGGAATATAGG - Intronic
1094370614 12:29733593-29733615 GTTAATTCTAGAAGGAATATTGG - Intronic
1100803187 12:98254531-98254553 TTTAGAACTGGAAGGAATATGGG + Intergenic
1102653932 12:114464026-114464048 GTTAGCACCAGGTTGAATCTGGG + Intergenic
1105873085 13:24527397-24527419 GTTAGCACTTCCAGGAAAATAGG - Intergenic
1106461323 13:29972944-29972966 GTTATCCCTAGGAGCAATTTGGG - Intergenic
1107419821 13:40235825-40235847 GCTACCACTAGGAGAAATACAGG - Intergenic
1112703199 13:102035815-102035837 TTTAGAGCTAGAAGGAATATTGG - Intronic
1114601489 14:23959090-23959112 GTAAGCACTTGGAGAAATGTGGG + Intronic
1114605671 14:23994220-23994242 GTAAGCACTTGGAGAAATGTGGG + Intronic
1114611179 14:24041859-24041881 GTAAGCACTTGGAGAAATGTGGG + Intergenic
1116848052 14:49882864-49882886 GTTAGCCCCAGGAGCAATTTGGG - Intergenic
1120111743 14:80565133-80565155 GTTATCACCAGGAGCAATTTGGG - Intronic
1125339271 15:38658597-38658619 GCTGGCACTGGGAGGAATAAAGG - Intergenic
1125864867 15:43037005-43037027 GTTAGCACTTGGAAGAAAAATGG - Intronic
1130795807 15:87208159-87208181 ATTAGTACTTGGAGGAAAATAGG + Intergenic
1132042967 15:98540636-98540658 ATTATCACAAGGAGGAATATTGG + Intergenic
1146535904 17:33651911-33651933 GTTTGCACTTGGAGGTAGATGGG + Intronic
1146794571 17:35772404-35772426 GTTAGGACCAGGAGGAATCTAGG - Intronic
1149403268 17:56320853-56320875 GATTGCACTACGAGGAATATGGG + Intronic
1153416810 18:4854916-4854938 GTTTGCATTTTGAGGAATATGGG + Intergenic
1154977921 18:21476917-21476939 GTTTGCACTTTGAGGTATATTGG + Intronic
1155282469 18:24253826-24253848 GTTATCCCCAGGAGGAATTTAGG + Intronic
1156476564 18:37409349-37409371 GTTTGAGCTAGGAGGAATCTTGG + Intronic
1158241217 18:55380388-55380410 GTTAGCATTAGGAGAAATACCGG - Intronic
1159797721 18:72865112-72865134 ATTAACAGTAGGAGGAAAATAGG + Intronic
1164817204 19:31213659-31213681 GTAAGCAACAGGAGGTATATGGG + Intergenic
925864461 2:8214324-8214346 GAGAGCACTAGGAGAAAGATTGG - Intergenic
926409096 2:12583090-12583112 GTTCCCAGTAGGAGGAAAATAGG + Intergenic
931386878 2:61805623-61805645 GTTTGCAATAGGAGGAAGAACGG - Intergenic
932040802 2:68297207-68297229 GTAAGTACTACGAGGAACATTGG + Intronic
932538554 2:72625757-72625779 TGTAGCACTAGAAGGAAAATAGG - Intronic
934894102 2:98098029-98098051 ATCAGCACTAGGAGGAACTTTGG - Intronic
936180122 2:110259254-110259276 GTTGGCAGGAGGAGGAAGATGGG - Intergenic
937492854 2:122388055-122388077 GTTATCTCTAGGAGCAATATGGG - Intergenic
945776022 2:214107132-214107154 GTTAGTAATAGTAGGAATTTTGG - Intronic
945869822 2:215214934-215214956 CTTAGCTTTAGGATGAATATTGG + Intergenic
946678638 2:222189631-222189653 GTTAGCACAGAGAGGAATCTAGG - Intergenic
1169776036 20:9254239-9254261 CTGAGCACTTGGAGAAATATAGG + Intronic
1173746965 20:45444963-45444985 GTTATCACCAGGAGCAATTTGGG + Intergenic
1176345883 21:5746263-5746285 GTTAGCCCTAGGGGAAATTTTGG - Intergenic
1176352697 21:5866847-5866869 GTTAGCCCTAGGGGAAATTTTGG - Intergenic
1176498944 21:7578192-7578214 GTTAGCCCTAGGGGAAATTTTGG + Intergenic
1176540204 21:8144333-8144355 GTTAGCCCTAGGGGAAATTTTGG - Intergenic
1176559155 21:8327378-8327400 GTTAGCCCTAGGGGAAATTTTGG - Intergenic
1179171258 21:38974742-38974764 GTTACCACTGGGAGGCATCTTGG + Intergenic
1181919202 22:26306994-26307016 GTAAGCACTAGGAGGCACATGGG + Intronic
1183499970 22:38173017-38173039 GTTATCACTAGGTGGAAGAAAGG + Intronic
1203245147 22_KI270733v1_random:60700-60722 GTTAGCCCTAGGGGAAATTTTGG - Intergenic
949789976 3:7782156-7782178 GTTATCTCTAGGAGAAATTTGGG + Intergenic
957533437 3:81470268-81470290 ATTAGCATCAGGAGGAATATAGG + Intergenic
957562734 3:81844379-81844401 CTTAGCAGAAGGAGGAAAATCGG + Intergenic
960284209 3:115809294-115809316 GATGGGACTAGGAGGAATATGGG + Exonic
960620265 3:119630402-119630424 GGGAGCACTAGCAGGAAAATGGG - Intergenic
960822399 3:121749083-121749105 ATTAGCATTAGCAGGATTATTGG + Intronic
960906461 3:122606590-122606612 GTCAACTATAGGAGGAATATAGG - Intronic
963620900 3:147604854-147604876 GTTAGCATAAGAAAGAATATGGG - Intergenic
963977946 3:151504007-151504029 GTTATCCCTAGGAGCAATTTGGG + Intergenic
968191238 3:196669009-196669031 GATTGCACTGGGAGGAAGATGGG - Intronic
970353771 4:15232408-15232430 ATTAGCATTAGAAGGAATTTGGG + Intergenic
970505370 4:16723864-16723886 GGTAGCAGGAGGAGGAATCTGGG - Intronic
970723043 4:19010112-19010134 GTTATCCCTAGGAGCAATTTAGG + Intergenic
971306505 4:25487151-25487173 GTTATCCCCAGGAGCAATATGGG - Intergenic
971493245 4:27236867-27236889 GGTATCACTAGGAGATATATTGG + Intergenic
973123259 4:46550454-46550476 GTTATCAATAAGAGAAATATTGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978032197 4:103948925-103948947 GTTACCACCAGGAGAAATTTTGG + Intergenic
978882151 4:113718505-113718527 GTTATCACCAGGAGCAATTTGGG + Intronic
978976825 4:114887112-114887134 TTTAGCACATTGAGGAATATTGG - Intronic
980222040 4:129930094-129930116 GTTACTCCTAGGAGGAATTTGGG - Intergenic
986990438 5:13546351-13546373 GTTAGCACTAAAAGATATATTGG - Intergenic
993630084 5:90276266-90276288 AGTAGCACTAAGAGAAATATAGG + Intergenic
993843112 5:92905727-92905749 GGCAGCACTAGTGGGAATATTGG + Intergenic
1001909316 5:175502198-175502220 GTTAGCCCCAGGAGCAATTTGGG + Intronic
1003293556 6:4803865-4803887 TTTTGTACTAGGAGGAATTTTGG + Intronic
1005624131 6:27647495-27647517 GTTATCCCCAGGAGCAATATGGG - Intergenic
1008220768 6:48851596-48851618 GTTAAGACTAGGCGGACTATTGG - Intergenic
1008332450 6:50260581-50260603 TTTAGCCCTAGGAGAAATGTTGG - Intergenic
1009297308 6:61968543-61968565 GTTACCACTAAAAGCAATATTGG + Intronic
1010404640 6:75489945-75489967 GGTAGCACTAGGAGAAATGAGGG - Intronic
1011057299 6:83218814-83218836 GCTAGCACTTTGAGGAATTTGGG - Intronic
1011590352 6:88965242-88965264 CTTGGGACTAGGAGCAATATAGG - Intergenic
1014370609 6:120602696-120602718 GTTTGCACAAGAAAGAATATAGG + Intergenic
1018786955 6:167115995-167116017 CTTTGAACTAGGAGGAAAATGGG - Intergenic
1020705329 7:11537096-11537118 GTTAGCACTAGGAGGAATATGGG - Intronic
1022370263 7:29764715-29764737 GGCAGCAGAAGGAGGAATATAGG - Intergenic
1030574334 7:111267113-111267135 GTTAGCACTAAAGGGAATTTTGG - Intronic
1033075388 7:138245319-138245341 GTTAGGACTAGGAGAAAATTTGG - Intergenic
1045136296 8:99222570-99222592 GTTAAAACTAGAAGGAATTTAGG + Intronic
1045814826 8:106267647-106267669 GTTAGCAAAAGAAGGAATAGGGG - Intergenic
1046160351 8:110354933-110354955 GTTACCACTAGGAGCATCATTGG + Intergenic
1047314750 8:123722645-123722667 ATTAGCATCAGAAGGAATATTGG - Intronic
1055455955 9:76471783-76471805 GTTAGCATTATGAGGTAGATTGG + Intronic
1055887776 9:81085094-81085116 GTATGCACTAATAGGAATATTGG - Intergenic
1058814264 9:108668929-108668951 GGTAGAACAAGGAGGCATATTGG - Intergenic
1059241003 9:112805351-112805373 GGTAGCAGGAGGAGGAATAATGG + Intronic
1059677836 9:116556658-116556680 GCTAGAGCTAGAAGGAATATTGG - Intronic
1060065697 9:120498629-120498651 GTTAACACTAGGGGATATATGGG + Intronic
1202630679 M:13981-14003 GTTAGGTCTAGGAGGAGTAGGGG - Intergenic
1203461482 Un_GL000220v1:43769-43791 GTTAGCCCTAGGGGAAATTTTGG - Intergenic
1186528366 X:10270394-10270416 GAAAGCACTAGAAGGAATGTGGG + Intergenic
1188085766 X:25899346-25899368 TTTAGCACAGGGAGGAATGTCGG - Intergenic
1188852609 X:35150651-35150673 TTTAGCCCTAGGGGAAATATTGG + Intergenic
1194641535 X:96408903-96408925 GTTATCCCTAGGAGCAATTTGGG - Intergenic
1196280571 X:113819311-113819333 GATAGCATTAGGAGAAATATGGG - Intergenic
1197041865 X:121946694-121946716 GTTAGCAGAAGGAAGAAAATAGG + Intergenic
1198086661 X:133288755-133288777 GGTAACACTAGTAGGAATTTAGG - Intergenic
1201480793 Y:14437557-14437579 GTTAACCCTAGAAGGAATTTGGG - Intergenic