ID: 1020707560

View in Genome Browser
Species Human (GRCh38)
Location 7:11564635-11564657
Sequence TGGGCTGTCTCCTGATTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020707558_1020707560 -4 Left 1020707558 7:11564616-11564638 CCAGGGTCTAGAGTCTAGATGGG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG 0: 1
1: 0
2: 1
3: 12
4: 189
1020707552_1020707560 21 Left 1020707552 7:11564591-11564613 CCATCTTAGCAGACAGAAACTCC 0: 1
1: 0
2: 1
3: 17
4: 165
Right 1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG 0: 1
1: 0
2: 1
3: 12
4: 189
1020707555_1020707560 0 Left 1020707555 7:11564612-11564634 CCTCCCAGGGTCTAGAGTCTAGA 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG 0: 1
1: 0
2: 1
3: 12
4: 189
1020707556_1020707560 -3 Left 1020707556 7:11564615-11564637 CCCAGGGTCTAGAGTCTAGATGG 0: 1
1: 0
2: 0
3: 1
4: 100
Right 1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG 0: 1
1: 0
2: 1
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020707560 Original CRISPR TGGGCTGTCTCCTGATTTCA AGG Intronic
900626778 1:3611938-3611960 AGGGCTGTCTCCTGAGATCGAGG - Intergenic
901611560 1:10502693-10502715 TGGGCAGTGTCCTTATTTCGAGG + Intronic
903082765 1:20824796-20824818 AAAGCTGTCTCCTGATTTCTGGG - Intronic
903399657 1:23032166-23032188 TGGGCTGACTTCTTAGTTCAAGG + Intronic
904511542 1:31014107-31014129 TGGGCTGTCACATGTTTTCCAGG - Intronic
904719183 1:32493901-32493923 TGGCATGTATCCTGATTTCTGGG - Exonic
907393979 1:54177032-54177054 TGAGCTGTGGCCTGATGTCATGG - Intronic
909279271 1:73727958-73727980 TGGATTGTGTCCTGATTTGAGGG + Intergenic
912043287 1:105418987-105419009 TGGATTCTCTCCTGATTGCAAGG - Intergenic
912066035 1:105744106-105744128 TTTCCTGTCTGCTGATTTCAGGG + Intergenic
912417081 1:109516650-109516672 TGGGCTGTCTCCTGCATCCTTGG + Intergenic
912580885 1:110719902-110719924 TTGTCTTTCTCTTGATTTCAGGG - Intergenic
913329832 1:117658317-117658339 TGGCCTGTCTCCTCCTTGCACGG + Intergenic
915074362 1:153296658-153296680 TGAGCTGGCTCTTGTTTTCACGG - Intergenic
919944508 1:202309529-202309551 TGGGCTCTGCCCTGATTCCAGGG - Intronic
920065931 1:203269730-203269752 TGAGCTGCGGCCTGATTTCATGG + Intronic
924474008 1:244367624-244367646 TGGGCTGTCTTCTGCTCTCTGGG - Intronic
1064359172 10:14647832-14647854 AGGGCTGTCTCCAGATGCCAAGG + Intronic
1065123669 10:22552489-22552511 TGTGCTGTCTTCACATTTCAAGG - Intronic
1065320858 10:24508416-24508438 TGGCCTTGCTCCTGATTTTATGG - Intronic
1066111692 10:32203103-32203125 TTGTCTCTCTCCTGATTTCTTGG - Intergenic
1066652727 10:37674073-37674095 TGGAATTTCTCCTGATTTAAAGG + Intergenic
1070158234 10:73849620-73849642 TGGGCTGTCTCCTGATCTCTTGG - Intronic
1070911205 10:80119923-80119945 TGGTCTGGGTGCTGATTTCATGG - Intergenic
1074289924 10:112130756-112130778 TGGGCCATCTCCAGATTTCCTGG + Intergenic
1075894871 10:125986492-125986514 AGAGTTGTCTCCAGATTTCACGG + Intronic
1075937386 10:126354214-126354236 TGGGTTGTCACCTGGTTTCTTGG + Intronic
1076383303 10:130039555-130039577 CATGCAGTCTCCTGATTTCAAGG + Intergenic
1077106429 11:844431-844453 GGGGCAGTCTCCAGATCTCAGGG - Exonic
1077149561 11:1064444-1064466 TGGTCTTGTTCCTGATTTCAGGG - Intergenic
1078411157 11:11120006-11120028 TGGGCTGCCTCCTGCCTCCAAGG - Intergenic
1080445080 11:32331171-32331193 TGGGCTTTCTCGTGATTCCTTGG - Intergenic
1080602092 11:33830035-33830057 AGGGCTGTCTGATGAATTCAAGG + Intergenic
1082910610 11:58369771-58369793 TAGGCCTTCTCCTGATTTTAAGG - Intergenic
1085567327 11:77526099-77526121 TAGGCTGCCTGCTGTTTTCAAGG - Intronic
1085658077 11:78335186-78335208 TGGGTTGTCTCTTCATTTTAGGG + Intronic
1099911979 12:88845074-88845096 TGAGCTGTATCATCATTTCAAGG + Intergenic
1100419625 12:94419663-94419685 TGGGCTGTGTCCTGTTTTATTGG - Intronic
1101570103 12:105945999-105946021 GGGGCTGACTCCAGATTTGAGGG + Intergenic
1101751069 12:107582768-107582790 TGTGCTGCCTCCTGTTTTCAGGG + Intronic
1102180514 12:110909189-110909211 TGGGCTGTGTCCTGGGTTCTTGG + Intergenic
1102756110 12:115342343-115342365 TGGGCTGTCGTCTCATTTGAAGG + Intergenic
1105465839 13:20639268-20639290 TGGGCTGTCTCCTGGTATTCAGG + Intronic
1107185856 13:37518914-37518936 TGAGATGCTTCCTGATTTCAGGG + Intergenic
1109618938 13:64875343-64875365 CAGGCTGTCTCCAGAGTTCATGG + Intergenic
1115538928 14:34400597-34400619 TGGGCTGTCTCTTCATTTTGTGG - Intronic
1116093559 14:40338617-40338639 TTCACTGTCTCCTGGTTTCAAGG - Intergenic
1119190375 14:72677752-72677774 TGGTCTGTCACCTGGTCTCATGG + Intronic
1121883161 14:97518261-97518283 TGGGCAGTGACCTGCTTTCAAGG - Intergenic
1121886397 14:97546741-97546763 TGGGCCCTCTCCTCCTTTCACGG - Intergenic
1122369224 14:101219688-101219710 TGGGTTTTCTCCTGATTATAGGG + Intergenic
1122886467 14:104712622-104712644 TGTGCTGTCTCCTGGCTCCAGGG + Intronic
1124258421 15:28164841-28164863 TTGGCAGTCTCCTGGTTTGAGGG - Intronic
1125357283 15:38829805-38829827 TGGGCTTTCTCATGTTTACAGGG - Intergenic
1125479459 15:40070183-40070205 TGGGCAGTCTCCAAATTTTAGGG + Intergenic
1128231103 15:66036040-66036062 TGGGCTTTCTCCCGAGTTCCAGG + Intronic
1128264561 15:66254810-66254832 TGGGCTGACTCCTGCTTACACGG + Intergenic
1128881974 15:71252269-71252291 TTGGTTGTTTCCTGATGTCATGG - Intronic
1129168644 15:73794338-73794360 TGGTCTGTCTCCCCATCTCAGGG + Intergenic
1129320266 15:74770863-74770885 TGGGCTGCTCCCTGATTTGAAGG - Intergenic
1130759706 15:86805961-86805983 TGGGGTCTATGCTGATTTCAGGG + Intronic
1131860334 15:96646438-96646460 TGGGCTGTCTTTTGAACTCAAGG + Intergenic
1132080472 15:98860365-98860387 AGGCCTGGCTCCTGCTTTCACGG - Intronic
1132561885 16:598972-598994 TGGGCTTTCGCCTGACTTCCTGG + Intronic
1133177269 16:4024911-4024933 TGAGCTCCCTTCTGATTTCATGG - Intronic
1135499532 16:22981692-22981714 TGGGCAGTCTATTGATTTCAGGG - Intergenic
1135697567 16:24603400-24603422 TGCTCTGTCTCCTCATCTCAGGG + Intergenic
1135959304 16:26982510-26982532 TGGGCTGCATCCTGAATACAAGG - Intergenic
1141165589 16:81658798-81658820 TGGGATGTCTCCTGGCTGCAAGG + Intronic
1142621840 17:1170189-1170211 AGGGCTGTCTCCTCATATCACGG + Intronic
1147969923 17:44213746-44213768 TGGGCTGAGTCCTGTTTCCAAGG + Intronic
1149956184 17:61053041-61053063 TGGGCTGTCTATTGATTTATAGG + Intronic
1151112499 17:71695764-71695786 TGTGCTTTTTCCTGATCTCAAGG - Intergenic
1152291884 17:79444449-79444471 TGGGCTGGCTCAAGACTTCATGG - Intronic
1153229073 18:2919870-2919892 AGGGCTGTCTTCAGATGTCAGGG - Exonic
1154343522 18:13523857-13523879 TGGGCTGTCTCCTGCTGCAAAGG - Intronic
1155094029 18:22538602-22538624 TGGGCGGTCTCCTGCTTTTCCGG + Intergenic
1157070134 18:44397031-44397053 TGGGCTGCATCCAGATTTCATGG - Intergenic
1158013378 18:52754899-52754921 TGGCCTGTCTCCTGAGTAGAGGG - Intronic
1161864965 19:6826908-6826930 TGGGCTGACCCCTGATATCAGGG + Intronic
1162229220 19:9251714-9251736 TTGGCTGTCTCCCTATCTCAGGG + Exonic
1163691237 19:18739576-18739598 TGGGCTGGCTGCTGGGTTCACGG + Intronic
926173613 2:10569770-10569792 TGGCCTGTTTCCTGACGTCAGGG - Intergenic
926276018 2:11403802-11403824 TCTGCTGTGTCCTGATTACATGG - Intergenic
928500568 2:31889984-31890006 TGTTTTGTCTCCTGATTTCTTGG - Intronic
929030532 2:37646367-37646389 TGTGCTTTCTCCTGGTTTCCAGG + Exonic
930017880 2:46983387-46983409 AGGGCTGGTTCCTGTTTTCATGG + Intronic
930024207 2:47020526-47020548 TGGGCTGCTTCCTGATTGCTGGG - Intronic
934578456 2:95418346-95418368 TGGCCTGTTTCCTGAGCTCAGGG - Intergenic
935354490 2:102186556-102186578 TGGGGTGTCTCCTGATGGCTAGG + Intergenic
935849373 2:107201657-107201679 GAGGCTGTCTACTTATTTCAGGG + Intergenic
936112529 2:109676658-109676680 TGGCTTGCCTCCTTATTTCAGGG - Intergenic
936534358 2:113300516-113300538 TGGCCTGTCTCCTGAGCTCAGGG + Intergenic
938323465 2:130381256-130381278 TGGGCAGGCTCCTGATCTAAAGG - Intergenic
939659351 2:144868902-144868924 TGGGCTGTCTCATGAAGTCTAGG - Intergenic
939959675 2:148555292-148555314 TGGGCTGTTTCCAGAGTACAGGG + Intergenic
942384300 2:175425016-175425038 TGTGCTGTCTCCTCAACTCAGGG - Intergenic
946042148 2:216791840-216791862 TGGTCTGTTTGCTGAGTTCAGGG - Intergenic
946746421 2:222850426-222850448 TTGGGTGCCTGCTGATTTCATGG + Intergenic
947507446 2:230719662-230719684 TGGGCTGGGTCCTGACTCCATGG + Intronic
947783451 2:232792181-232792203 TGAACTGTCTCCTGTTTTCTAGG + Intronic
948799053 2:240422296-240422318 TTGGCTGCCTTCTGATTTCTAGG - Intergenic
1168928040 20:1598936-1598958 TCTCCTGTCTCCTGATTTCCAGG - Intronic
1168994638 20:2124047-2124069 TGGACTGACTCCTGGGTTCAAGG - Intronic
1169940108 20:10927709-10927731 TTCTCTGTCTCCTGATTCCAAGG + Intergenic
1170122518 20:12926174-12926196 AGGGCTGTGTCCTGAGTTCTGGG - Intergenic
1172753906 20:37270122-37270144 TGGGCTTTCTCCTGAGATCCTGG - Intergenic
1173235648 20:41243188-41243210 GGTGCTTTCTCCTAATTTCATGG - Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1176104189 20:63377988-63378010 TGGGCCGTCTTCTGGTCTCAAGG + Intronic
1178926256 21:36777777-36777799 AGTGCTGTCTCCTGACATCAGGG + Intronic
1179949728 21:44702974-44702996 AGGGCTGTCTCATGGTTTCCTGG - Intronic
1180694338 22:17742394-17742416 TGGGGTTTCTCCTCAGTTCAGGG + Intronic
1183978877 22:41528249-41528271 TGGGCTGTCCCCTGAGTGCCAGG - Exonic
949421671 3:3872582-3872604 TGCCCTTTCTCCTTATTTCATGG + Intronic
949879423 3:8649827-8649849 GGGGCTGTCTCCTGACTTACAGG - Intronic
950183372 3:10930349-10930371 AGGGCTGGCTCCTGTTCTCACGG - Intronic
950935690 3:16836635-16836657 TGGCCTTTTCCCTGATTTCAGGG - Intronic
956048894 3:65226032-65226054 TCGTTTTTCTCCTGATTTCAAGG - Intergenic
959446445 3:106446197-106446219 TGTTCTGTATCCTGATTTCATGG + Intergenic
959871761 3:111337133-111337155 TGGGCATTTGCCTGATTTCATGG + Intronic
960056753 3:113281376-113281398 AGGTCTATCCCCTGATTTCATGG - Intronic
960356147 3:116655895-116655917 TGGGCTGTTCACTTATTTCAGGG - Intronic
964827131 3:160840862-160840884 TGGGCTGTCAGCTGATTGGATGG + Intronic
966385149 3:179388298-179388320 TAGGTAGACTCCTGATTTCATGG + Intronic
966591443 3:181687896-181687918 TGGCCTGTGGCCTGATTTCCTGG + Intergenic
968076837 3:195820628-195820650 TGGCCTCTCTCCTGGTTTCCAGG + Intergenic
968562634 4:1292700-1292722 TGGGCTGGATCCTGCTTTAAGGG + Intronic
968600227 4:1505223-1505245 TGCCCTGCCTCCTGATGTCATGG + Intergenic
968607224 4:1541243-1541265 TGGGGTGTGTCCTGGTCTCAGGG - Intergenic
968615600 4:1576382-1576404 TGGGCTGTCCCCTCAAATCACGG - Intergenic
969585101 4:8087136-8087158 AGGGGTTTCTCCTGATTTCTGGG - Intronic
969883915 4:10198383-10198405 TGGGCTGTATCCTAATTTGGGGG - Intergenic
971381456 4:26102468-26102490 TGGACTGTGTCCTGAGTTCCTGG - Intergenic
971525472 4:27612273-27612295 TGAGCAGTTTACTGATTTCAAGG + Intergenic
972975204 4:44625892-44625914 TAGGCTGTCTCTGGTTTTCATGG + Intronic
973937977 4:55869958-55869980 TTGGCAGTTTCCTTATTTCAGGG + Intronic
974129909 4:57741766-57741788 TGGGCTGTGTCATATTTTCATGG + Intergenic
976198336 4:82555701-82555723 TGGGCTGTCACCAGATTGCGTGG + Intronic
980694278 4:136336373-136336395 TGGGGGATCTCCTGAGTTCAGGG - Intergenic
981256102 4:142661798-142661820 TGGACTGTCTCCTGTTTTGAAGG - Intronic
986412282 5:7492957-7492979 CGGGCTGCATCCTGAGTTCATGG + Intronic
988449384 5:31325267-31325289 TGAGCTATTTCCTGCTTTCAGGG + Exonic
988611311 5:32728607-32728629 TGAGCTGTTTTCTTATTTCAAGG - Intronic
988703863 5:33703890-33703912 TGCTCTCTTTCCTGATTTCATGG - Intronic
989975661 5:50583738-50583760 AGGGCTATCTCCTTATTTCAAGG - Intergenic
992006089 5:72478866-72478888 TGGGCTTTGGACTGATTTCAGGG - Intronic
992768026 5:80020610-80020632 AGGGCTGACTGCTGTTTTCAGGG - Intronic
993209547 5:84930845-84930867 TGCTCTGTCTACTGATTTAAAGG + Intergenic
994414229 5:99447961-99447983 AGGTCTGTATCCTGATTGCAGGG - Intergenic
997674250 5:135700970-135700992 AGAGCTGCCTCCTGATTCCAAGG - Intergenic
998526145 5:142845036-142845058 TGAGCAGACTCCTGATTTCTTGG + Intronic
1001558704 5:172655173-172655195 TGAGCCTTCTGCTGATTTCAAGG - Intronic
1002776135 6:329106-329128 TGAGCTGTCTCCTCTTTGCAAGG - Intronic
1005072461 6:21874466-21874488 GGGGCTGTTTCCAGATATCAGGG + Intergenic
1005327216 6:24714354-24714376 TCGTCTGTCTCCTGTTTTCTAGG - Exonic
1006763125 6:36481208-36481230 TGGTTTGGATCCTGATTTCATGG - Intronic
1007112024 6:39318374-39318396 TGGAATGTCACCTGAGTTCAAGG + Intronic
1007204811 6:40140300-40140322 TGGACTGACTCCTGATATCGGGG - Intergenic
1007314031 6:40970126-40970148 GGGGCTGTCTCCTGCCTTCAAGG - Intergenic
1007822304 6:44569675-44569697 AGGGCTGTCTCCTCTGTTCATGG + Intergenic
1010076495 6:71804056-71804078 TGGGGTGTCTCCTGAGTCCTGGG + Intergenic
1016053040 6:139550273-139550295 TGGCCAGGCTCCTGACTTCAGGG + Intergenic
1016692578 6:146955223-146955245 AGAGCAGTCTCCTGAATTCATGG - Intergenic
1019808991 7:3150255-3150277 GGGGCTGCCTCCGGTTTTCAGGG - Intronic
1020707560 7:11564635-11564657 TGGGCTGTCTCCTGATTTCAAGG + Intronic
1029986981 7:104931374-104931396 TGCCCTGCCTCCTGATTTCCTGG + Intergenic
1031652658 7:124309838-124309860 ATGTCTGTCTCATGATTTCATGG + Intergenic
1032432613 7:131874063-131874085 TCTGCTGTCTCCGGATGTCATGG - Intergenic
1033342790 7:140505133-140505155 TGGGATGTCTCCTGAGGACAAGG + Intergenic
1035009667 7:155702961-155702983 TGGGCTGGCTGTGGATTTCATGG + Intronic
1035784571 8:2250598-2250620 TGCGCTCTCACCTGAGTTCAGGG - Intergenic
1035808236 8:2471115-2471137 TGCGCTCTCACCTGAGTTCAGGG + Intergenic
1036791896 8:11726592-11726614 GGGGCTCTCTCCTGCTCTCAAGG - Intronic
1036961906 8:13253920-13253942 TGGGCTGCGTCCTGACGTCAGGG - Intronic
1037556032 8:20023478-20023500 TGGCCTGTCTCTTTAATTCATGG + Intergenic
1041393247 8:57366570-57366592 TGGGCTGTCTCCACATGCCATGG - Intergenic
1042512962 8:69630521-69630543 TTTGATGTCTCTTGATTTCAGGG + Intronic
1045280471 8:100745508-100745530 TGAACTGTCTTCTGATATCATGG - Intergenic
1045800096 8:106092341-106092363 TGGGCTGGCTCCTGACTTCTTGG + Intergenic
1048123873 8:131611511-131611533 TGAGTTCTCTCCTGAGTTCATGG - Intergenic
1049763136 8:144339744-144339766 TGGGCTGTCCACTTATTTCCTGG - Intergenic
1050092250 9:2026899-2026921 TGGGCTCTCTAGTGAATTCAAGG + Intronic
1051903196 9:22064711-22064733 TGGGCTGCCTCCTGTGTGCACGG + Intergenic
1052747465 9:32454394-32454416 TGGGATGACTCTTCATTTCAGGG + Exonic
1056946709 9:91003881-91003903 TAGGTTGTCTGTTGATTTCATGG + Intergenic
1057001494 9:91513927-91513949 GGGGCGGTCTCCTGAACTCAGGG + Intergenic
1059550662 9:115225675-115225697 TGGGCAGTCTCCTGTTGCCATGG - Intronic
1060407083 9:123378149-123378171 TGGGTTGTCTGCTGAGTACAGGG + Exonic
1062122112 9:134839405-134839427 TGAGCTGTCGGGTGATTTCATGG - Intronic
1062306423 9:135909437-135909459 TTGTCTTGCTCCTGATTTCAGGG + Intergenic
1185540342 X:898287-898309 TGACGTGTCTCCTGCTTTCAAGG + Intergenic
1186689334 X:11958556-11958578 TTATCTCTCTCCTGATTTCATGG + Intergenic
1193885317 X:86977343-86977365 TGAGCTGTCTCCAGATGTCTTGG - Intergenic
1198074051 X:133177881-133177903 CTGGCTTTCTCCTTATTTCATGG - Intergenic
1198181206 X:134211149-134211171 TTTTCTGTCTCCTAATTTCAAGG - Intergenic
1199466032 X:148138257-148138279 TGTACTGCATCCTGATTTCAAGG + Intergenic
1199693796 X:150329121-150329143 TGGCCAGTCACCTGATTCCAGGG + Intergenic
1199952282 X:152715780-152715802 GGAGCTGTCTGCTCATTTCAGGG + Intronic
1199954911 X:152734971-152734993 GGAGCTGTCTGCTCATTTCAGGG + Intronic
1199957401 X:152752668-152752690 GGAGCTGTCTGCTCATTTCAGGG - Intronic
1201399800 Y:13593135-13593157 TGGGCTCTCTCCAGACTTAAAGG + Intergenic
1201584484 Y:15545859-15545881 AGTTCTGTCTCCTGATGTCAGGG + Intergenic