ID: 1020711287

View in Genome Browser
Species Human (GRCh38)
Location 7:11608743-11608765
Sequence GGTTGTGGATGTTCATCTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020711287 Original CRISPR GGTTGTGGATGTTCATCTAA GGG (reversed) Intronic
902290431 1:15431464-15431486 GGATGTGGATGTTCCTCTCTTGG - Intergenic
909198750 1:72661380-72661402 AGTTGTGGTTCTTCCTCTAAGGG + Intergenic
909316393 1:74224430-74224452 GTTTGTGGATATTCATCTTTGGG - Intronic
911375621 1:97047169-97047191 AGTTATGGATGTTCATAGAAGGG + Intergenic
916371334 1:164098648-164098670 GGATGTAGATGTTGATCAAAGGG - Intergenic
918917031 1:190655530-190655552 GGTAGTGGATATTTAACTAATGG - Intergenic
919108735 1:193189962-193189984 GGTGGATGATTTTCATCTAATGG + Intronic
919699590 1:200618164-200618186 ACCTGTGGATCTTCATCTAAAGG + Exonic
920724065 1:208417197-208417219 GGTCGTGGATGTTCATTTAGTGG - Intergenic
921952406 1:220944128-220944150 GTTTATGGTTGTTTATCTAAGGG + Intergenic
1064994787 10:21287078-21287100 GGTTGTGGATTTTCAGCTTCTGG - Intergenic
1068631841 10:59306330-59306352 TGTTCTGGAGGTTTATCTAATGG - Intronic
1072464057 10:95646832-95646854 GGTTGTCCATGTTCTTCTTAAGG + Intronic
1079955869 11:26864067-26864089 TGTTGTGGCTGTGAATCTAATGG - Intergenic
1087488477 11:98790616-98790638 GATTGTGGCCATTCATCTAATGG - Intergenic
1087798629 11:102480539-102480561 GGATGTGGATGTTAATTTTAAGG - Intronic
1088096863 11:106111106-106111128 GTTTGTGGATGATGATCTAGTGG + Intergenic
1092125734 12:6073915-6073937 GATGGAAGATGTTCATCTAAGGG - Intronic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1101843816 12:108346123-108346145 GGGCCTGGATGCTCATCTAATGG - Intergenic
1105242863 13:18622967-18622989 GGTGGTGGTTGTTCAGCAAAGGG + Intergenic
1107272253 13:38633905-38633927 AGTTGTGGAACTTCATCTAGTGG - Intergenic
1113226570 13:108166491-108166513 GGCTGTGGATGTTAATATAATGG + Intergenic
1116826070 14:49674912-49674934 GCTTGTGCATTTTCATCTCAAGG + Intronic
1117208993 14:53476063-53476085 CTCTGAGGATGTTCATCTAATGG - Intergenic
1123544930 15:21330710-21330732 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1129462522 15:75706731-75706753 GGTTGTGGATTATTATCTGATGG + Intronic
1130695823 15:86130228-86130250 GGTAGTGTATGTTCATCTGCTGG - Intergenic
1202953279 15_KI270727v1_random:57981-58003 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1140550245 16:75857227-75857249 GGTTGTGGTTCCTCATCTCATGG - Intergenic
1143619047 17:8070758-8070780 TGCTGTGGATGTTCATATAGGGG - Intergenic
1144345575 17:14346215-14346237 GGATGTGGATGTCCCTGTAAAGG - Exonic
1149762881 17:59248593-59248615 TGTTGGGGATGTTCTGCTAAGGG + Intronic
1154446071 18:14436910-14436932 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1156022941 18:32620468-32620490 GGTTGAGGATGTTGCTGTAAGGG + Intergenic
1159654227 18:71012382-71012404 GTCTGTTGATGTACATCTAATGG + Intergenic
1159740442 18:72161763-72161785 TATTGTGGATGTTCAACAAAAGG + Intergenic
1162258413 19:9512356-9512378 GGATGTGGAGGTTCATCTGAGGG + Intergenic
926266308 2:11325199-11325221 GGTAGTGGATGTGCAACTCACGG - Intronic
931875040 2:66503254-66503276 GGTTGTGGGTGTTCATCCCTAGG - Intronic
935577430 2:104725389-104725411 GGTTCTGGATGGTCAACTCAGGG - Intergenic
941251746 2:163173548-163173570 AGTTGTGGATATTTCTCTAAGGG - Intergenic
942700465 2:178702472-178702494 CATTGTGGATGGTCATATAATGG + Exonic
943498313 2:188652609-188652631 GGTGGTGGCTGTTCAGCTTATGG + Intergenic
945149725 2:206777383-206777405 GGTTGTTGAATTTCATCAAATGG + Intronic
945712734 2:213319567-213319589 GATTTTGTATATTCATCTAATGG + Intronic
947241267 2:227996929-227996951 GCTTCTGGATCTTCATCTACAGG - Intronic
947449041 2:230188675-230188697 TGTTGAGGATCTTTATCTAAAGG + Intronic
1168910644 20:1444097-1444119 GGTTGTTGGTGTTTATCTCAAGG - Intronic
1170118799 20:12890512-12890534 AATTGTGGATGTTCATGCAATGG + Intergenic
1170197224 20:13701901-13701923 GGGGGTAGATGTTCATCAAATGG + Intergenic
1173722863 20:45274798-45274820 GATTGTGGATATTCATATAATGG - Intergenic
950261927 3:11548733-11548755 AGGTGTGGATGTGCATCAAATGG + Intronic
956114455 3:65904440-65904462 GGTTTTGGATTTTGTTCTAAGGG - Intronic
959086990 3:101862038-101862060 TGATTTGGATGTTCATATAAAGG + Intergenic
962990744 3:140574943-140574965 GGTCATGGATGTTAATATAAAGG + Exonic
963583143 3:147152222-147152244 GGTTTTCGATGTTCACCTACAGG + Intergenic
969035129 4:4247312-4247334 GGTTTCCGATGGTCATCTAAAGG - Intronic
974677373 4:65110906-65110928 TGTTGTTGTTGTTCATGTAATGG - Intergenic
977508015 4:97926482-97926504 GGTGGAGCATGTTCTTCTAATGG - Intronic
981272859 4:142865059-142865081 GATGGTGGATATTTATCTAATGG - Intergenic
983781770 4:171677547-171677569 GGTTGTGGAAGTTCATACCAGGG - Intergenic
985811943 5:2096773-2096795 GGTTTTGGATGTTTACCTGAAGG - Intergenic
987962717 5:24831235-24831257 GTTTGTGGATTTTCTTATAATGG - Intergenic
988489821 5:31696902-31696924 GGTTCTGCTTGTTCATCTGAAGG + Intronic
990873875 5:60462727-60462749 GGTAGTGAATGATCATCTTAAGG - Intronic
998770848 5:145543429-145543451 AGTTGTGGCTCTTTATCTAATGG + Intronic
1001739798 5:174043286-174043308 ACTACTGGATGTTCATCTAAAGG - Intergenic
1002652605 5:180712193-180712215 GGGTGTGTATGTACATCTCAAGG + Intergenic
1007162458 6:39802818-39802840 GGTGGTGGATGTTCAGTTTATGG - Intronic
1011096400 6:83669854-83669876 ATTTTTGTATGTTCATCTAATGG - Intronic
1011507710 6:88066556-88066578 GCTTGGGGATATTTATCTAAAGG + Exonic
1013275269 6:108579062-108579084 AGTTCTGGATGTTCATGTGAGGG + Intronic
1014730111 6:125022552-125022574 GGGTGTGGTTGTTCCTTTAAGGG + Intronic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1024527693 7:50362792-50362814 GGTTGAGGATGATAATCTTAGGG + Intronic
1027364008 7:77438336-77438358 GGTTTTGGTTTTTCATCAAAGGG - Intergenic
1028114356 7:86981001-86981023 GATTCTGGGTGTTCATCTGATGG + Intronic
1029258241 7:99283947-99283969 GGTTGTCGATGGTCATCTTCAGG - Intergenic
1034020608 7:147637769-147637791 GATTGTGTATTTTCATCCAAAGG + Intronic
1035698855 8:1622630-1622652 GTTTGTGGATGACAATCTAAGGG + Intronic
1042403380 8:68375469-68375491 GCTTGTGCATGTCCATTTAATGG - Intronic
1043686802 8:83096598-83096620 GTTTATGGATATTCATCTATAGG + Intergenic
1043934239 8:86125146-86125168 GGTTGAGGATGTTAAGGTAATGG + Intronic
1044086009 8:87942902-87942924 GGTTGTGGATGATGAACTCAAGG - Intergenic
1044240270 8:89880269-89880291 GGTTGTGGCAGTTCATATAATGG + Intergenic
1047161279 8:122382896-122382918 GGTTGGGGATGTTGATATGAAGG - Intergenic
1049499550 8:142954479-142954501 AGTTGTGGATATTCATCAAATGG - Intergenic
1052532174 9:29700309-29700331 GATTGTGGATCTACATCTTAAGG + Intergenic
1053433997 9:38063223-38063245 GAGTGTGGCTGTTCATCAAATGG + Intronic
1054810304 9:69429019-69429041 GGTTATGTATGTTCACCTAAAGG - Exonic
1203519275 Un_GL000213v1:31575-31597 GGTGGTGGTTGTTCAGCAAAGGG - Intergenic
1189475537 X:41352149-41352171 GGATGTGGCTGTTCACCTAGAGG - Intronic
1190952117 X:55156320-55156342 TGTTGTGGAGGTTCACATAAAGG - Intronic
1192718112 X:73664742-73664764 AGTTGTTGTTGTTCATCGAATGG + Intronic
1193758638 X:85439280-85439302 TCTTGTGGATGGTCATCTCAGGG + Intergenic
1197260244 X:124309529-124309551 CGTAGAGGATGTTCAACTAATGG - Intronic