ID: 1020713197

View in Genome Browser
Species Human (GRCh38)
Location 7:11635341-11635363
Sequence TTGGATAAACCAGACCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020713197 Original CRISPR TTGGATAAACCAGACCATCT GGG (reversed) Intronic
901617832 1:10555983-10556005 CTGGACAAAGCAGTCCATCTCGG + Intronic
907923614 1:58935611-58935633 TTAAGCAAACCAGACCATCTGGG - Intergenic
907981964 1:59491710-59491732 TTGAATAAGCCAGAGCAACTAGG - Intronic
911893079 1:103397212-103397234 TAGGAGAGTCCAGACCATCTGGG - Intergenic
916726012 1:167525091-167525113 TTGGATAAACCAGTGCTTCCAGG + Intergenic
920377141 1:205515048-205515070 TTGATAAAACCAGACCTTCTGGG + Intronic
922325522 1:224524804-224524826 AGGGATAAACCACACAATCTCGG - Intronic
923242341 1:232097952-232097974 TTGCATACAGCAGGCCATCTTGG - Intergenic
1066236540 10:33490337-33490359 TTGGATAATACACCCCATCTCGG + Intergenic
1068870070 10:61933939-61933961 TTGGGCAAAAAAGACCATCTAGG - Intronic
1070564859 10:77595948-77595970 TTGGATAAACTAACCTATCTGGG - Intronic
1071229008 10:83563840-83563862 GAGGATAAAACAGTCCATCTTGG - Intergenic
1075621883 10:123934155-123934177 TTGGGTACAGCAGACCCTCTTGG - Intronic
1077784728 11:5371020-5371042 TTGGAAAAACCAGTCCCTTTGGG - Intronic
1078300015 11:10119881-10119903 TTGTATAAATCAGAATATCTTGG + Intronic
1078363198 11:10686080-10686102 TTGGGGAAACCTGACCATTTGGG + Intronic
1084796709 11:71511031-71511053 TTGGCTGAACCAGGCCATCTTGG - Intronic
1085946083 11:81275488-81275510 TAGGCTAAACCTAACCATCTAGG + Intergenic
1090050199 11:123371240-123371262 TTGGGTAATCCCCACCATCTTGG + Intergenic
1090526415 11:127543549-127543571 TTCCAGAAACCAGACCAACTTGG - Intergenic
1090908405 11:131097024-131097046 TTGTATAAGCCAGGCCATCCAGG - Intergenic
1090926574 11:131255517-131255539 TTCCAGACACCAGACCATCTTGG - Intergenic
1097767975 12:63547418-63547440 ATGGATGAGCAAGACCATCTTGG - Intergenic
1097784335 12:63742484-63742506 ATGGATGAGCAAGACCATCTTGG - Intergenic
1098979110 12:76935937-76935959 TTGGCCAGACAAGACCATCTAGG - Intergenic
1100134941 12:91543854-91543876 TTGGAGAATTCAGACCAACTGGG + Intergenic
1103381612 12:120497991-120498013 TTGGATAAGCCAGAGCCTGTAGG - Intronic
1105616087 13:22014056-22014078 AAGGATTAACAAGACCATCTGGG - Intergenic
1106879254 13:34111537-34111559 TTGGATAAACAAAAGGATCTGGG - Intergenic
1107532605 13:41298631-41298653 TGGTATAAACCAGAGAATCTGGG + Intergenic
1111826286 13:93272153-93272175 TTGTATAAACTAGACCACTTTGG + Intronic
1130748167 15:86678686-86678708 TTGGATAAACCTGTCTACCTCGG + Intronic
1133264136 16:4573135-4573157 TTGGAGAAACCATGCCTTCTCGG + Intronic
1137599692 16:49748255-49748277 TTCCATAAAGCAGACCTTCTTGG + Intronic
1141734173 16:85841129-85841151 TTGGATAACCCAGAGCCACTGGG + Intergenic
1148206416 17:45783109-45783131 TTGGGTACACCAGAGCACCTGGG - Intergenic
1149233885 17:54568717-54568739 TTAGGTAAACCACACAATCTGGG - Intergenic
925139970 2:1543395-1543417 ATGGATAAAACAGACCATCGAGG + Intronic
926297121 2:11577137-11577159 TTGGATGAACCACTCAATCTGGG - Intronic
926886561 2:17604010-17604032 ATGGATATCCCAGGCCATCTGGG + Intronic
927066476 2:19476409-19476431 TTGGATAAACCAGGGAAGCTTGG - Intergenic
929719334 2:44351400-44351422 TTGGATATACAAGTTCATCTTGG - Intronic
934106732 2:88701772-88701794 TTGGATAAAACAGACAATAGAGG + Intronic
938013487 2:127847971-127847993 TTGGAGAAAACAGCCCAGCTTGG - Exonic
938244173 2:129764626-129764648 TTGGAAGGACCTGACCATCTAGG + Intergenic
938843010 2:135181187-135181209 CTGCATAAGCCAGACCAGCTGGG - Intronic
939412535 2:141848374-141848396 GTGAACAAAACAGACCATCTGGG + Intronic
945973586 2:216253691-216253713 TTGGAAAAACCCAACCACCTTGG + Intergenic
945986182 2:216355734-216355756 TTGCAAAGACCAGACCCTCTGGG + Intronic
949024181 2:241757608-241757630 ACAGATAAAGCAGACCATCTTGG + Intronic
1174099086 20:48113445-48113467 TTAGACAAACCAGTCCAGCTGGG - Intergenic
1175275430 20:57765854-57765876 TTGGGAAATCCAGACCATCCTGG + Intergenic
1178756204 21:35352600-35352622 TTGGTTAAGCCAACCCATCTGGG - Intronic
1181494187 22:23278757-23278779 TTGGAGAAGCCAGACCCTGTTGG + Intronic
949530226 3:4948084-4948106 TTGGGGAAATCAGACCATTTGGG + Intergenic
950526426 3:13526781-13526803 CTGGAGACACCAGACCACCTCGG - Intergenic
950620571 3:14202220-14202242 TTTAATAAACCAGAGCATGTAGG + Intergenic
953733644 3:45472171-45472193 ATGGCTTAACCAGACCATTTTGG - Intronic
963008654 3:140749625-140749647 ATGGATAAACCAGAGCATGTGGG - Intergenic
963260602 3:143187722-143187744 CAGGATAAATCATACCATCTGGG + Intergenic
965549995 3:169954755-169954777 TTGGAAAAAGCAGACATTCTAGG - Intergenic
966440028 3:179934342-179934364 TTGAATAAACCAGGCTATTTAGG + Intronic
971253987 4:24997064-24997086 TTGGACAAACCTTACCCTCTTGG - Intergenic
973116615 4:46468069-46468091 GTGCATAAACCAGACTAACTGGG - Intronic
977345047 4:95807188-95807210 TTAGATAAACCAGCTCATCTGGG + Intergenic
980223359 4:129948161-129948183 TTGGAAAAAGCATAGCATCTGGG + Intergenic
980956844 4:139437550-139437572 TAGGCTATACCATACCATCTAGG - Intergenic
982869989 4:160566902-160566924 TTGGATGAAACAGAACATCGAGG - Intergenic
986194049 5:5521489-5521511 TTGAGTAAAACAGCCCATCTTGG + Intergenic
990278309 5:54223281-54223303 TTGGTTAAAAAAGACCACCTAGG + Intronic
991964381 5:72076698-72076720 CTGGGTAAATCAGACAATCTAGG + Intergenic
993972557 5:94438039-94438061 TTGGATCAACCAGGACATCTTGG - Intronic
994020660 5:95021068-95021090 TTAGCTGAGCCAGACCATCTAGG + Intronic
994608570 5:102005386-102005408 TTTTATAAACTAGATCATCTTGG + Intergenic
995411128 5:111858341-111858363 GTGGAAAAACCAGATCATGTAGG - Intronic
996013298 5:118504367-118504389 AAGGAGAAACCAGACCATGTGGG - Intergenic
1000526435 5:162364267-162364289 TTGGATGATCGAGACCATCCTGG - Intergenic
1003904182 6:10683817-10683839 TTGGTTAACCCAGACCCTGTTGG + Intronic
1015650872 6:135457639-135457661 TGGGATAAACCGGGCTATCTCGG + Exonic
1017749358 6:157476295-157476317 TTGGATAAACTAGAAGATATGGG + Intronic
1019065689 6:169294798-169294820 TCAGAAAAACCAGACAATCTGGG + Intergenic
1020713197 7:11635341-11635363 TTGGATAAACCAGACCATCTGGG - Intronic
1022443942 7:30454926-30454948 CTCTATAAACCAGACCATCGAGG + Intronic
1028030145 7:85901626-85901648 TTAGATTAACCAGGTCATCTAGG - Intergenic
1029318507 7:99736241-99736263 TTGGGTCAACCTGGCCATCTGGG - Intergenic
1030941699 7:115658779-115658801 TAGGATAAACAAAACCATGTTGG - Intergenic
1037070170 8:14635976-14635998 TTTGATTAACCAAACCTTCTTGG - Intronic
1037173000 8:15916036-15916058 TTGGATAAACAAAACACTCTTGG + Intergenic
1043868130 8:85399076-85399098 TTGGATAAACCAAATCATGTGGG + Intronic
1044427089 8:92064246-92064268 CTGGATAAAGCAGCCCTTCTTGG - Intronic
1047780749 8:128109162-128109184 TTGCACATACCAGACCATCCTGG + Intergenic
1052766911 9:32650739-32650761 TTGGAGAATCCAGGGCATCTGGG + Intergenic
1055464800 9:76553931-76553953 TAGGCTATACCATACCATCTTGG - Intergenic
1059055967 9:110979915-110979937 TTGGATAACCAAGAGCATTTAGG + Intronic
1060514887 9:124259245-124259267 TTGGAAAAGTCAGACCAACTAGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1185939181 X:4295437-4295459 TTGGATAAACAGGACAAGCTTGG - Intergenic
1187058152 X:15760386-15760408 TTTACTAAACTAGACCATCTAGG - Intronic
1187537241 X:20153487-20153509 TTAGATAAACCACACTCTCTTGG + Exonic
1192615403 X:72616062-72616084 TTGGATAAAACAGACTTTCAGGG + Intronic
1194188635 X:90807661-90807683 TTGGAGAGGCCAAACCATCTGGG - Intergenic
1198159613 X:133994370-133994392 TATGATAAACCAGAGCATCAAGG - Intergenic
1200535219 Y:4389556-4389578 TTGGAGAGGCCAAACCATCTGGG - Intergenic