ID: 1020713220

View in Genome Browser
Species Human (GRCh38)
Location 7:11635671-11635693
Sequence CTGCTCTAAACAACAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020713220_1020713222 -9 Left 1020713220 7:11635671-11635693 CCCTGGGTTGTTGTTTAGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1020713222 7:11635685-11635707 TTAGAGCAGATTTTGTTTATAGG No data
1020713220_1020713223 -8 Left 1020713220 7:11635671-11635693 CCCTGGGTTGTTGTTTAGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1020713223 7:11635686-11635708 TAGAGCAGATTTTGTTTATAGGG 0: 1
1: 0
2: 1
3: 20
4: 267
1020713220_1020713224 15 Left 1020713220 7:11635671-11635693 CCCTGGGTTGTTGTTTAGAGCAG 0: 1
1: 0
2: 0
3: 10
4: 149
Right 1020713224 7:11635709-11635731 TAATTCTGAAAATGCTGTCTTGG 0: 1
1: 0
2: 4
3: 25
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020713220 Original CRISPR CTGCTCTAAACAACAACCCA GGG (reversed) Intronic
901400712 1:9013631-9013653 TTGATCTAAACAAAAACACAGGG + Exonic
902895654 1:19478143-19478165 CTGCTGAAAACAGCAGCCCAGGG - Intronic
903141076 1:21339534-21339556 CTGCTCTTCACACCAACCCCAGG - Intronic
907421422 1:54349983-54350005 CCGCTCTAAACCCCAACCCTGGG + Intronic
907682682 1:56578936-56578958 CGGCGCTCAACAACAACCCGAGG - Exonic
915202205 1:154239533-154239555 ATGCTCTAAACAACAGACTAGGG - Intronic
917744476 1:177994436-177994458 CTTCACTAAACCAAAACCCATGG + Intergenic
918132160 1:181638943-181638965 CTGCTATAAAGAACTGCCCAAGG - Intronic
918833005 1:189422770-189422792 CTGCTATAAAGAACTTCCCAAGG - Intergenic
919315831 1:195969723-195969745 CTGCTCTATCAAGCAACCCAGGG - Intergenic
919828623 1:201522247-201522269 CTGCTTAAAACAACAACAGAGGG + Intergenic
920176394 1:204104507-204104529 CTGCCCTAAACAATAGGCCAAGG - Intronic
922119448 1:222649464-222649486 CTGCTATAAAGAAATACCCAAGG + Intronic
922343416 1:224676033-224676055 CTGCTATAAACATCTACACAAGG - Intronic
924673923 1:246156312-246156334 CTGCCCTCATCAACATCCCAGGG - Intronic
1063094701 10:2899174-2899196 CTGCTGTAAACAACTACCTGAGG + Intergenic
1063487849 10:6436711-6436733 TTGATCTATAAAACAACCCAAGG - Intronic
1064463735 10:15559237-15559259 CTTCTCTGACCAAGAACCCAAGG + Intronic
1068487507 10:57678658-57678680 CTGCTGTAAAGAACTGCCCAAGG + Intergenic
1068851488 10:61747604-61747626 CTGCTAGAAACAAGAAACCAGGG - Intronic
1069295521 10:66839177-66839199 CAGCTCTAAAAAGCAAACCAAGG - Intronic
1069334986 10:67338106-67338128 CTGCTGTAAAGAAATACCCAAGG + Intronic
1070121853 10:73585293-73585315 CTGCTATAAAGAAATACCCAAGG + Intronic
1078014246 11:7599567-7599589 TTCCTCTAAACATCATCCCATGG + Intronic
1081101719 11:39010384-39010406 TTGCTCAAACCAAAAACCCAGGG + Intergenic
1085816365 11:79741493-79741515 CTGCTATAAAGAACTACCCGAGG - Intergenic
1086173932 11:83867667-83867689 CTGTTCTAAACAAGAATCAATGG + Intronic
1088076061 11:105849811-105849833 TAGCTCTAAAAAACAACCCTAGG + Intronic
1088999049 11:115033875-115033897 CTGCTATAAACAACTGCCCGAGG + Intergenic
1097222991 12:57461420-57461442 CTGCTATAACCAGCAACCTAAGG + Intronic
1101282787 12:103276624-103276646 CTGCTGTCAACCACAACCAATGG + Intronic
1102719635 12:115004974-115004996 CTGCTCCAAACAAGAACACAAGG - Intergenic
1107168022 13:37305887-37305909 CTACTCTTAACTATAACCCATGG - Intergenic
1109090874 13:58043784-58043806 CTGCTCAAATTTACAACCCAGGG - Intergenic
1109158986 13:58948816-58948838 CTGCTCTAAAGAGCTACCTAAGG + Intergenic
1109546614 13:63841973-63841995 CTTCTCTAAACAACTAGACAGGG + Intergenic
1110065226 13:71096149-71096171 CTGCTATGAAGAAAAACCCAAGG + Intergenic
1110150236 13:72243358-72243380 CTGCTATAAAGAACTGCCCATGG + Intergenic
1110892209 13:80706895-80706917 CGTCTCTAAACAACTACCCAAGG + Intergenic
1114244399 14:20899384-20899406 CTGCTATAAAGAACTACCTAGGG + Intergenic
1116375240 14:44190896-44190918 CTGCTATAAAGAACAACCTGAGG - Intergenic
1117500374 14:56345110-56345132 CTGCTGTAAAGAAATACCCAAGG - Intergenic
1124436545 15:29653730-29653752 CTGCTGTAAAGAACTGCCCAAGG - Intergenic
1125647034 15:41281277-41281299 GTGGTCTAAACAAGAAGCCAGGG - Exonic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1125806290 15:42496414-42496436 CTGCTATAAAGAAGTACCCAAGG + Intronic
1126374130 15:47977512-47977534 CTGATTCAAACAACCACCCAGGG + Intergenic
1127623208 15:60754331-60754353 CTGCTCTTAACACCAACATATGG + Intronic
1128497875 15:68208547-68208569 CCGCTCTAAGCCACAGCCCATGG + Intronic
1129243333 15:74264781-74264803 CTTCTCCCTACAACAACCCAAGG + Intronic
1129590409 15:76909821-76909843 CTGCTATAAACAAACACCCAAGG - Intergenic
1129627062 15:77212711-77212733 CATCTATAAACAACAAACCAGGG + Intronic
1129684900 15:77680202-77680224 CTGGTCCACACAACAACTCAGGG - Intronic
1131730611 15:95276037-95276059 CACCTATACACAACAACCCAGGG + Intergenic
1140027078 16:71300495-71300517 CTGCAAGAAACAATAACCCAAGG - Intergenic
1142032879 16:87847160-87847182 CAGCTCTAAGCCACAGCCCAGGG + Intronic
1146534229 17:33636032-33636054 CTTCTCTAAACAACATTTCATGG - Intronic
1149035224 17:52126233-52126255 CTGCTCTAAATAACTAGCAAGGG + Intronic
1150484632 17:65535227-65535249 CTTCTCCAAACAAAAACACAAGG + Intronic
1150613683 17:66752934-66752956 CTGCTCTAAAACACAAGGCAGGG - Intronic
1156355668 18:36338339-36338361 CTGCTGTAAAGGACAGCCCAGGG + Intronic
1156469460 18:37368324-37368346 CTACTCTAGACCACAACTCAGGG + Intronic
1156836617 18:41562658-41562680 ATGCTTGAAACAAAAACCCATGG + Intergenic
1157657843 18:49409475-49409497 CTGCTCTCCACCACAACTCAGGG + Intronic
1159498555 18:69238314-69238336 CTGCTATAAAGAACAGCCCGAGG + Intergenic
1160390133 18:78523771-78523793 CTGCTCTAGAAAACACCCCTGGG - Intergenic
1161983446 19:7642182-7642204 CTGCCCTAAACCCCACCCCAGGG + Exonic
1164595585 19:29529106-29529128 CGGCTCTCAACAAACACCCAGGG - Intronic
925264531 2:2557636-2557658 CTGCTGTAAACATCCACCCCTGG + Intergenic
925801676 2:7608171-7608193 CTGCTATAAAGAACTGCCCAAGG + Intergenic
926025636 2:9541670-9541692 CTGGTTTAAAAAACAAGCCATGG - Intronic
927184165 2:20470228-20470250 CTGCTATAAAGAACTGCCCAAGG + Intergenic
930050084 2:47208346-47208368 CTGCAGTAAAAAACAACACAAGG - Intergenic
930378181 2:50594163-50594185 CTGCTCTAAAGAACTGCCCGAGG - Intronic
930429814 2:51260824-51260846 CTGTTCTGAACAACAACTGAGGG + Intergenic
930786607 2:55277406-55277428 CTGATTTAAAGAACAACTCAGGG + Intergenic
933650474 2:84846310-84846332 ATGATCCAAATAACAACCCAGGG + Intronic
938300446 2:130207566-130207588 CTGCTATAAACAACTACCTGAGG + Intergenic
938456283 2:131466911-131466933 CTGCTATAAACAACTACCTGAGG - Intronic
940319338 2:152359260-152359282 TTAATCTTAACAACAACCCAAGG + Intronic
942188624 2:173448904-173448926 ATGCTCTAAACAATATCCTAGGG + Intergenic
942835650 2:180293704-180293726 CTGCTATAAGGAACTACCCAAGG - Intergenic
944326877 2:198416577-198416599 ATGTTCTAAGCAACAACCAATGG - Intronic
945357726 2:208858969-208858991 CTGCTATAAAGAACTGCCCAAGG - Intergenic
945775818 2:214104618-214104640 CTGCTCAAACAAACAAACCAAGG - Intronic
947474169 2:230427928-230427950 CTGCTCTAAAGAACTACCTGAGG + Intronic
1170559656 20:17546093-17546115 CTGCTATAAAGAACTTCCCAAGG + Intronic
1173126058 20:40337038-40337060 CTGCATTAAACAACAAGCCAGGG + Intergenic
1174975854 20:55332828-55332850 CTGCTATTAACAAAAACACAGGG + Intergenic
1175597680 20:60248283-60248305 CTGCTATAAAGAACTGCCCAAGG + Intergenic
1177083906 21:16677731-16677753 CTGCTTTAAGCCAAAACCCAAGG - Intergenic
1177190356 21:17844775-17844797 CTGCTATAAAGAACTACCCGAGG + Intergenic
1177346177 21:19874507-19874529 CTGCTATAAAGAAATACCCAAGG + Intergenic
1177418471 21:20825322-20825344 CTGCTATAAAGAACTGCCCAAGG + Intergenic
1177517820 21:22177568-22177590 TTGCTATAAATAACTACCCAAGG - Intergenic
1177705945 21:24705118-24705140 CTGCTCTCACCAAAACCCCAGGG - Intergenic
1179394581 21:41026817-41026839 CTGCTCTAAGGAACTTCCCAAGG + Intergenic
950657566 3:14446098-14446120 CTTCTCTATGCAACAACCTAGGG - Intronic
951360039 3:21714167-21714189 CTGCTCTCAATTAAAACCCATGG + Intronic
955413353 3:58670195-58670217 CTGCTCTACTCACCAGCCCATGG + Intergenic
956935197 3:74092848-74092870 CTTGTCTGAAAAACAACCCAGGG + Intergenic
957544848 3:81624015-81624037 CTGCTATAAAGAACTGCCCAAGG + Intronic
961137084 3:124521148-124521170 GTGCTCTACACAACAAGGCAAGG - Intronic
961435207 3:126912110-126912132 CTTCTCTCAACAGCAACACAGGG - Intronic
963246004 3:143063272-143063294 TTGCTCTAAAGAAATACCCAAGG - Intergenic
966314176 3:178626440-178626462 CTGCTATAAAGAACTGCCCAAGG + Intronic
967378405 3:188830862-188830884 CTGGACTCAACAACAATCCAGGG - Intronic
967833998 3:193945507-193945529 TTGCTCTACACAGCAACCCACGG - Intergenic
968482748 4:843702-843724 CTGCTATAAAGAAATACCCAAGG + Intergenic
968789566 4:2650288-2650310 CTGCTCTAGAGCACATCCCATGG + Intronic
970744652 4:19280634-19280656 CTGCTATAAAGAACTACCCAAGG + Intergenic
971138707 4:23899754-23899776 CTGCCCCAAACCACCACCCATGG - Intronic
971142676 4:23941636-23941658 CTGCTCTAAAAAGCAACACTAGG - Intergenic
971740848 4:30519072-30519094 CTGCTATAAAGAACTGCCCAAGG + Intergenic
971752318 4:30666494-30666516 CTCCTCTAAACCAAAACTCAGGG - Intergenic
975588070 4:75970954-75970976 CTGCTATAAAGAACAACCTGAGG - Intronic
977645512 4:99407280-99407302 CTGCTATAAAGAACTGCCCAAGG + Intergenic
980596423 4:134961511-134961533 CTGCTATAAAGAAATACCCAAGG - Intergenic
984206016 4:176789013-176789035 CTACTCTCAATAACAACCCCAGG + Intronic
984831774 4:183982547-183982569 ATTCTCTAAACAAAAACCCTGGG - Intronic
986332180 5:6725677-6725699 CTGCTTTAAAAAACAAACCACGG - Intronic
987893521 5:23914999-23915021 CTCCTCTCTCCAACAACCCAAGG + Intergenic
990664354 5:58054857-58054879 CTGCTATAAAGAACTACCCAAGG - Intergenic
992002597 5:72450381-72450403 GGGCTCTAAACAGCATCCCAGGG + Intronic
992902920 5:81317168-81317190 CTGCTATAAAGAACTACCCAAGG + Intergenic
994918637 5:106012477-106012499 CTGCTGTAAAGAAACACCCAAGG + Intergenic
996119390 5:119653545-119653567 CTGCTGGAAAGAACTACCCAAGG - Intergenic
1003566457 6:7226826-7226848 CTTCTCAACCCAACAACCCAAGG - Intronic
1009648637 6:66443861-66443883 CTGCTATAAAGAACTTCCCAAGG - Intergenic
1009772986 6:68167272-68167294 CTGCTCAAAACACCAAGCCTGGG - Intergenic
1011022925 6:82834423-82834445 CTGCTATAAAGAAATACCCAAGG + Intergenic
1012974389 6:105764361-105764383 CTGCTTTAACCAACAAAGCATGG - Intergenic
1015228381 6:130884918-130884940 CTGCTTTGAACAACAATCAAAGG + Intronic
1015560759 6:134512883-134512905 CTTCTCTAAATAACAATACAAGG - Intergenic
1015652401 6:135478099-135478121 CTGCTCTAAAGAACTACCTGAGG - Intronic
1016840275 6:148518350-148518372 CTGCTATTAAATACAACCCAAGG - Intronic
1018443393 6:163834058-163834080 CAGCCCTAATAAACAACCCAAGG - Intergenic
1018915153 6:168128516-168128538 CTCCTCTAAGCAGCAGCCCAGGG + Intergenic
1020713220 7:11635671-11635693 CTGCTCTAAACAACAACCCAGGG - Intronic
1021553342 7:21895304-21895326 CAACTCTTAACAACAACTCAGGG - Intronic
1021782806 7:24122536-24122558 CTGCTCTAAACCCCAACTCTGGG + Intergenic
1021822122 7:24508608-24508630 ATGTTCTAAAGAACAACTCAGGG + Intergenic
1023384538 7:39642725-39642747 CTGCTCCCAACAGCAAACCAAGG - Intronic
1024473254 7:49784789-49784811 CTGATCTAAACAAACACACACGG + Intronic
1030069636 7:105687768-105687790 CTGCTCTGAAACACAGCCCAAGG - Intronic
1030229493 7:107192116-107192138 CTGCTCTCAATAAAAACCCTAGG - Intronic
1034083608 7:148303098-148303120 CTGCTATAAAGAAATACCCAAGG - Intronic
1034125500 7:148667955-148667977 CTGCTATAAAGGAAAACCCAAGG - Intergenic
1035655398 8:1301388-1301410 CTGCTCTCAACAGCAACTGATGG + Intergenic
1047041813 8:121005333-121005355 ATTCACTAAGCAACAACCCATGG - Intergenic
1052391795 9:27887678-27887700 CTCATCTAGACAACAAACCATGG + Intergenic
1060478472 9:124001944-124001966 ATGCTCAAGACAACAACCCTTGG + Intronic
1060977044 9:127770988-127771010 CTACTCTACACAACAGCCCCAGG - Intronic
1061356347 9:130108497-130108519 GTGCTCTAAATAACAACCTAGGG - Intronic
1187122011 X:16418640-16418662 CTGCTCAAAACAAGACTCCAGGG + Intergenic
1187278816 X:17840508-17840530 CTGCTTAAAAAAAAAACCCAAGG + Intronic
1188941727 X:36246381-36246403 CTGCTATAAAGAACTGCCCAAGG + Intronic
1193867812 X:86757878-86757900 CTGCTATAAAGAACAACCTGAGG - Intronic
1195032085 X:100936238-100936260 CTGCTATAAAGAAATACCCATGG + Intergenic
1195859024 X:109360818-109360840 CTAATCTTCACAACAACCCAGGG - Intergenic