ID: 1020713845

View in Genome Browser
Species Human (GRCh38)
Location 7:11644078-11644100
Sequence CACAATACACAAAAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 445}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020713845 Original CRISPR CACAATACACAAAAGAATGA AGG (reversed) Intronic
902849574 1:19143449-19143471 CACAATACACAATACAGTCAAGG - Intronic
904035508 1:27556583-27556605 CATAATACAAATAACAATGATGG + Intronic
905088932 1:35411025-35411047 AACCACATACAAAAGAATGAAGG - Intronic
906969834 1:50500188-50500210 TACAATAGCCAAAAGAATTATGG + Intronic
907696755 1:56738665-56738687 CAAAAGACACAAAAGAGTTAAGG + Intronic
907871769 1:58449985-58450007 AATAATGCATAAAAGAATGAGGG + Intronic
908158675 1:61384483-61384505 CATAATACACAAATGAAAGAAGG - Intronic
908409639 1:63850295-63850317 TATAATACACAAAAAAATGAAGG - Intronic
908861013 1:68489776-68489798 CACAATATACTAAAGAAAAAAGG - Intronic
909272807 1:73645550-73645572 CACAAGACAAAAAAAAATTATGG - Intergenic
909344671 1:74571718-74571740 GGAAACACACAAAAGAATGAGGG - Exonic
909753638 1:79195388-79195410 CACAAAATACAAAAAAAAGAAGG + Intergenic
909855511 1:80524663-80524685 AACAAGATACAAAAAAATGAAGG - Intergenic
911894637 1:103416470-103416492 CACCATACACTGAAGAATTATGG + Intergenic
911908809 1:103604888-103604910 CACAATACACCAAAGCTTGTGGG + Intergenic
911914108 1:103674573-103674595 CACAATACACCAAAGCTTGTGGG - Intronic
912443970 1:109719526-109719548 GACAATACATAAATGAATGGTGG + Intronic
913709422 1:121466918-121466940 AACAATACATAAATGAATTAAGG - Intergenic
914194246 1:145436789-145436811 CATTAGAAACAAAAGAATGAGGG + Intergenic
914778749 1:150763909-150763931 CAAAATACATAATAGAGTGAAGG - Intronic
915677449 1:157544802-157544824 CTCACTTCACAAAATAATGAAGG + Intronic
915685701 1:157630453-157630475 CTCACTTCACAAAATAATGAAGG + Intergenic
915964101 1:160291582-160291604 CACAACACAAAATAGGATGATGG + Intronic
916846794 1:168659407-168659429 CATAATACACACAACAATTAAGG - Intergenic
918915266 1:190627833-190627855 CACATGTCACAAAAAAATGAAGG - Intergenic
919115118 1:193271998-193272020 CCCAATTCAGTAAAGAATGATGG + Intergenic
919191503 1:194226905-194226927 AACAACACTCAAAAAAATGAGGG - Intergenic
920165721 1:204034429-204034451 CTCAATAAAAAAAAGAAGGAAGG - Intergenic
920177574 1:204112706-204112728 AACAAAACAAAAAAGCATGAGGG + Intronic
921014844 1:211179724-211179746 CTCAAAACAAAAAAGAAAGAGGG - Intergenic
921134395 1:212247313-212247335 CACAATACACAGAAGAATGCTGG - Intergenic
921198827 1:212784581-212784603 TAGAAAACACAAAATAATGAAGG + Intronic
921388297 1:214593273-214593295 AACAATAAACAAAAGAAAGCTGG + Intergenic
921394183 1:214650942-214650964 AACAAAAAACAAAAGAAGGAAGG + Intronic
921736055 1:218629962-218629984 CACAATAAACTAAATATTGATGG - Intergenic
923418398 1:233788033-233788055 CCCAATACAAAAAAGAAAGCAGG - Intergenic
924471597 1:244347521-244347543 AAAAGTAAACAAAAGAATGAGGG + Intergenic
924531371 1:244896680-244896702 TAAAATAAACAAACGAATGATGG - Intergenic
924921145 1:248630419-248630441 CATAATTCACAAAAAAAGGAGGG + Intergenic
1062996787 10:1873688-1873710 CACATTACTCAAAAGAAAAAAGG + Intergenic
1063269996 10:4497495-4497517 CACAAGACACTAAAGACTGGTGG + Intergenic
1063510585 10:6641524-6641546 CATAATAGAGAAAAGAAAGATGG - Intergenic
1063621735 10:7655573-7655595 CAAAATAAATAGAAGAATGAGGG + Intronic
1064420790 10:15189097-15189119 AAGAATAAATAAAAGAATGACGG - Intergenic
1065590050 10:27254174-27254196 CTCAACACACAATAGAATTAAGG - Intergenic
1065877110 10:30006987-30007009 CACAAAAAGCAAATGAATGAAGG + Intergenic
1066405311 10:35112891-35112913 CACACTACATAAAAGAATTCAGG + Intergenic
1067792761 10:49300301-49300323 GACAATATGCAAATGAATGAAGG - Intronic
1068004096 10:51372265-51372287 CTCAATACACACAAAAATGCAGG - Intronic
1068629589 10:59285515-59285537 CACTATGCAAAACAGAATGATGG + Intronic
1069105039 10:64373319-64373341 CACAAAACACTAAAGAAGAAGGG - Intergenic
1069664403 10:70145340-70145362 CACAATACTCAAGAGTATTAGGG + Intronic
1070402419 10:76065342-76065364 CAAAATACACAATAGAAAGAAGG + Intronic
1071125136 10:82325477-82325499 AACAATACCCAAAAGAAAGCTGG - Intronic
1072828172 10:98629493-98629515 CAAAAAACACAAAAGAAGGATGG - Intronic
1073505595 10:103985916-103985938 CACATTACATAAACAAATGAGGG - Intronic
1074429644 10:113383106-113383128 CAGCATAAACAAATGAATGAAGG - Intergenic
1074942937 10:118252446-118252468 CATTAAACACAAAAGACTGAAGG + Intergenic
1074970826 10:118535367-118535389 CAGAATACACAGAAGACAGAAGG - Intergenic
1075354436 10:121757867-121757889 CAGAATACACACAAATATGAGGG - Intronic
1076023233 10:127091447-127091469 CACAATTCAAAAAGGAAAGAGGG - Intronic
1076285538 10:129292507-129292529 CATAATACCCAACAGAAGGATGG - Intergenic
1076301337 10:129429469-129429491 CAAAAAAGAAAAAAGAATGAGGG + Intergenic
1077381734 11:2245943-2245965 CACAATTCATAAAAGAAAGGTGG + Intergenic
1079219586 11:18548422-18548444 CAAAAAACAAAAAAGAAAGATGG - Intronic
1079668059 11:23133153-23133175 TACAAGACACAAAAGATTGGGGG - Intergenic
1080093908 11:28382051-28382073 CCAAATAAACAAAAGAAAGAAGG - Intergenic
1080499676 11:32857876-32857898 CACAAAATATAGAAGAATGAAGG - Exonic
1081779156 11:45697882-45697904 GACACTTCAGAAAAGAATGAAGG + Intergenic
1082122314 11:48392292-48392314 AACAAAATACAAAACAATGAAGG - Intergenic
1082638396 11:55624900-55624922 CAACATACACAAATCAATGAAGG - Intergenic
1083844847 11:65325341-65325363 CACAATAAAAAAAAAAATGCGGG - Intergenic
1085242045 11:75065021-75065043 AACAATAGACAAAATAATAATGG + Intergenic
1087527001 11:99328230-99328252 CAGAATTGACAAAATAATGAAGG + Intronic
1088338525 11:108736479-108736501 CCCAATACCAAAAAGAATCAAGG - Intronic
1089705664 11:120275879-120275901 CACATTCAACAAAACAATGATGG - Intronic
1089718515 11:120388751-120388773 GACAATCCACAAAAGAAGTATGG - Intronic
1090774700 11:129953276-129953298 CACAAAACACACAGAAATGACGG - Intronic
1091006407 11:131957610-131957632 GACAATACACATAAAAATAAAGG + Intronic
1091465679 12:682165-682187 CAAAAAACGAAAAAGAATGAGGG - Intergenic
1092339832 12:7666216-7666238 AACAAAACAAAAAAGAATGATGG - Intergenic
1093327445 12:17795203-17795225 CAAAATACGCAAATGAAAGATGG + Intergenic
1094004311 12:25731174-25731196 CAGAGTACAGAACAGAATGAGGG + Intergenic
1094824927 12:34262609-34262631 CAAAAAAGAAAAAAGAATGATGG - Intergenic
1095690484 12:45082948-45082970 GTCAATACACAGAAGCATGAAGG + Intergenic
1097539733 12:60925143-60925165 AAAAACACAGAAAAGAATGAGGG + Intergenic
1097799330 12:63895908-63895930 CATGATACACTAAAGAATAAAGG - Intronic
1097802639 12:63931844-63931866 GAGAATAGACAAAGGAATGAGGG + Intronic
1098409229 12:70162043-70162065 CACTATAAAGAAAAGTATGAAGG + Intergenic
1098655541 12:73024642-73024664 CAGAATACCCAAAAGAATGAAGG + Intergenic
1099839787 12:87951157-87951179 CACATTATAGAAAAGAATAATGG + Intergenic
1099963692 12:89422023-89422045 AAAAAGATACAAAAGAATGAAGG - Intronic
1100055300 12:90502303-90502325 GACAATACATAAATGAATGAGGG - Intergenic
1100648424 12:96557318-96557340 GACAATAAGCAAAAGAAAGAAGG + Intronic
1101165219 12:102022911-102022933 CAAAATACTCAAAAGAGTTAAGG - Intronic
1101576939 12:106006604-106006626 CACAATACAAATAGAAATGAGGG - Intergenic
1102232477 12:111273127-111273149 CAGAATACACAACAGAAAGCAGG + Intronic
1102241883 12:111329614-111329636 CAAAAAACACAAAAAACTGAGGG - Intronic
1103437469 12:120937836-120937858 CACAATTCACTAAGGAGTGAGGG - Intergenic
1103650666 12:122429791-122429813 CACTACACACAAAAAAATTAAGG + Intergenic
1106152410 13:27118489-27118511 CACAATCCACTAAAAATTGATGG + Intronic
1106780199 13:33051538-33051560 AACAAAACAAAAAAGAGTGATGG + Intronic
1107095925 13:36535228-36535250 TACAATACACATGAGAATGTAGG + Intergenic
1108002719 13:45919584-45919606 CACAATAAACTAAAGGTTGAAGG - Intergenic
1108126337 13:47248333-47248355 CACAATAGAAAACAGAATGAAGG - Intergenic
1108491736 13:50988917-50988939 GACCAAACACTAAAGAATGAAGG - Intergenic
1108494683 13:51013272-51013294 CACAATAGAGAAAAAAATCAGGG - Intergenic
1108794728 13:54017702-54017724 CACCACACACAAAACAAGGAAGG + Intergenic
1109384126 13:61605628-61605650 CACAATACAAAACAGAAACAAGG + Intergenic
1109490708 13:63096231-63096253 TACATTACAAATAAGAATGATGG + Intergenic
1109575266 13:64248528-64248550 CAGAATGAACAAAGGAATGAAGG - Intergenic
1109948382 13:69468170-69468192 CACAATACACCACAAAATTATGG + Intergenic
1109964220 13:69670567-69670589 CAAAATACACAAATCAATAAAGG + Intergenic
1110338136 13:74356544-74356566 CACAGGATACAAAAGAATGCAGG - Intergenic
1110652152 13:77954108-77954130 CACAAGAAACAAAAGAAAAAAGG - Intergenic
1110784177 13:79503671-79503693 CACAAAACAAAAAGTAATGATGG - Intronic
1111072788 13:83190064-83190086 CACAAAACACAAAAAATAGATGG - Intergenic
1111158451 13:84359934-84359956 CACAATATAAAAAAGAATTAAGG - Intergenic
1111982648 13:95033269-95033291 AAAAATACAGAAAACAATGAAGG + Intronic
1112351582 13:98639411-98639433 TAGAATACACAAAAAAATTATGG + Intergenic
1113024847 13:105929176-105929198 CTGAATTCATAAAAGAATGATGG + Intergenic
1113830867 13:113294769-113294791 AACAAAACAAAAAAGAAAGAAGG + Intergenic
1114361987 14:21983926-21983948 CACACTACATAACACAATGAGGG - Intergenic
1115786052 14:36827064-36827086 CACAATCCACAAAACAAACAGGG - Intronic
1116276167 14:42835004-42835026 CATAATACACAACAAGATGATGG + Intergenic
1116453449 14:45090087-45090109 CAAAATACAAAAAAGACTGTAGG - Intronic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1117653911 14:57934849-57934871 GAAAAGACACAGAAGAATGAGGG + Intronic
1120102292 14:80459096-80459118 TACAAGACACAAAAGAAAAAAGG - Intergenic
1122656216 14:103261179-103261201 CACAATACACAATACTATTAAGG - Intergenic
1123962494 15:25419740-25419762 CATAATACCAAAAAGAATGAGGG + Intronic
1124989729 15:34659740-34659762 AAAAATGCACAAAAGTATGATGG + Intergenic
1125638695 15:41211422-41211444 AACAATAAAAAAAAAAATGAGGG - Intronic
1125810071 15:42531619-42531641 CAGAAAACAAAAAAGAAGGAGGG - Exonic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1129292468 15:74578891-74578913 CTCAAAAAACAAAAGAAAGAAGG + Intronic
1129636857 15:77328724-77328746 CACAATTCACAGAAAAGTGATGG + Intronic
1129982970 15:79891322-79891344 CAAAATACAAAATAGAAGGATGG + Intronic
1131670706 15:94616648-94616670 CACAATGCAGAAAAGAATTGAGG - Intergenic
1132165987 15:99590772-99590794 GACAATAGCAAAAAGAATGAAGG - Intronic
1132184794 15:99793860-99793882 CCCAGTACACAAAAGAGTGCTGG + Intergenic
1132432189 15:101770782-101770804 CCCAGTACACAAAAGAGTGCTGG - Intergenic
1133497891 16:6337214-6337236 CCCAAAACACCAAAGAAGGAGGG + Intronic
1135606690 16:23831974-23831996 AACAAAAAACAAAAGAATAAAGG + Intergenic
1135692002 16:24545881-24545903 CAGACTAAACTAAAGAATGACGG + Intronic
1137773075 16:51033666-51033688 GAAAATACAGAAAAGAATAAAGG - Intergenic
1140350825 16:74260606-74260628 CTCAAAAAACAAAATAATGATGG + Intergenic
1140987257 16:80169925-80169947 CACAATGCACAAAAGGACGGCGG + Intergenic
1143778403 17:9214912-9214934 CACTAAAGACAAAACAATGAAGG - Intronic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1145742242 17:27285045-27285067 AACAAGAAACAAAAGAGTGAAGG + Intergenic
1146512118 17:33459071-33459093 CACAAAAAACAAAAAAACGAAGG - Intronic
1149131201 17:53304430-53304452 CCCACAACACAAAAGAATTATGG + Intergenic
1149471279 17:56916969-56916991 CAAAAAACACAAAAGAAACAAGG - Intergenic
1150381830 17:64726894-64726916 AACAAAAAACAAAAGAATGTTGG - Intergenic
1153461770 18:5342514-5342536 CATAATACAGAAAAGGAAGATGG - Intergenic
1153537916 18:6122628-6122650 CGCAATTTACAAAAGAAGGAGGG - Intronic
1153957765 18:10112669-10112691 TTCAATAAACAAAAGAATAAAGG - Intergenic
1156141430 18:34115947-34115969 CCCAATACTCAAATGAATTAAGG - Intronic
1156763518 18:40622863-40622885 GAAAATACAGAAAAAAATGAAGG - Intergenic
1156962334 18:43047862-43047884 TACATTACACAAAAATATGAGGG + Intronic
1157500518 18:48187278-48187300 CACAATAGCCAAAAGACGGAGGG + Intronic
1157748963 18:50161391-50161413 CAAAACACACAAAACCATGAAGG + Intronic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1159083043 18:63756746-63756768 CAAAATACACAATAGAAATATGG - Intronic
1159791457 18:72784890-72784912 CACAGTGAACAAAAGAATGAGGG + Intronic
1159812201 18:73029654-73029676 AACAATAAACAAAAGAAAGCAGG + Intergenic
1159949389 18:74470294-74470316 AACAGTACCCAAAAGAAAGACGG - Intergenic
1160596175 18:79975952-79975974 CACAGTAGAGAAAAGGATGAGGG + Intronic
1164052762 19:21597172-21597194 CACAATACACAATAAATTCAGGG - Intergenic
1164975666 19:32571115-32571137 CACAATATAAAGAAAAATGATGG + Intergenic
1165553798 19:36611565-36611587 CACAATAGCCAAAAGATGGAAGG - Intronic
1165564123 19:36708814-36708836 CACAAAATACAACAGAATGTAGG - Intronic
1166233435 19:41439416-41439438 CAGAAAACTCAAAAGCATGATGG - Intronic
1167602307 19:50461461-50461483 CACAAGACACAGACGAAAGAAGG - Intronic
924988972 2:295052-295074 CACACTACACCAAACAATGCAGG - Intergenic
925127834 2:1473815-1473837 AACAAAACAAAAAAGAAAGAAGG + Intronic
925885250 2:8389962-8389984 CACAATAAAGAAAGGAAAGAAGG - Intergenic
926265134 2:11309410-11309432 CAGTATACACAAAATAAAGATGG + Intronic
926775190 2:16415081-16415103 CAGTACAAACAAAAGAATGAAGG + Intergenic
927068776 2:19503093-19503115 CACAATAAACAAAACATTGCAGG + Intergenic
927147120 2:20173537-20173559 CTCAATAAGCAAATGAATGAAGG + Intergenic
928563651 2:32519137-32519159 CACAATAAACCAAAAAATTAGGG - Intronic
928588709 2:32790749-32790771 AACTATACAGAAAGGAATGATGG - Intronic
928625294 2:33133660-33133682 GACAGTACAGAAATGAATGAGGG + Intronic
928995235 2:37282477-37282499 GATAATACACCAAAGAATCATGG + Intronic
929100706 2:38310576-38310598 GACAATACAAAAAATTATGAAGG + Intronic
929651499 2:43684233-43684255 CAGAAAACACAAGACAATGAAGG - Intronic
930951729 2:57150723-57150745 CAAAATACACAAATCAATAAAGG + Intergenic
932086485 2:68767226-68767248 AACGAAACTCAAAAGAATGATGG + Intronic
932136655 2:69236971-69236993 AAAAATACACAAAAAAAGGAAGG - Intronic
933360399 2:81275343-81275365 TACAATACACAAAAAATTAATGG + Intergenic
933408229 2:81889988-81890010 CAGAATGCACACAAGAATGGAGG + Intergenic
934576991 2:95408851-95408873 CACGATACAGAAATGAATGATGG + Intronic
934639245 2:96017256-96017278 GACGATACAGAAATGAATGATGG + Intergenic
934794403 2:97088155-97088177 GACGATACAGAAATGAATGATGG - Intronic
936392149 2:112085109-112085131 AACAATAAACAAAAGAACAAAGG - Intronic
936406334 2:112207825-112207847 AACATTAAACAAAAGAAAGATGG - Intergenic
936831690 2:116655008-116655030 GGCAATTTACAAAAGAATGAGGG + Intergenic
936890801 2:117367327-117367349 GGCAATTTACAAAAGAATGAGGG + Intergenic
937630292 2:124094103-124094125 CACAATAAATCAAAGAATGTTGG + Intronic
937675656 2:124587254-124587276 CACAATACAGTATATAATGAGGG - Intronic
937779049 2:125816274-125816296 CAGAACAAACAAAAGAAAGAAGG + Intergenic
937783905 2:125873105-125873127 CACACAACACAGATGAATGAGGG + Intergenic
938325221 2:130393876-130393898 CACAAAACAGAAAAGGAAGAAGG + Intergenic
938567822 2:132535915-132535937 CACAATAAAAAAAACAATAAAGG - Intronic
939251128 2:139682816-139682838 GAGATTACAGAAAAGAATGAGGG - Intergenic
939317377 2:140568056-140568078 CACAAGAAACAAAAAAAAGAAGG + Intronic
939744815 2:145955876-145955898 CACACAAGAGAAAAGAATGAAGG - Intergenic
940132059 2:150393003-150393025 CAAAATACACTATAGAAAGATGG - Intergenic
940334964 2:152516781-152516803 CACAACACAGAACAGAATGATGG - Intronic
940387724 2:153093125-153093147 TACACTATACAAGAGAATGAAGG - Intergenic
940521568 2:154757203-154757225 CCCAAAACACAAAACAAGGATGG - Intronic
940717241 2:157240317-157240339 CACAAAACACAAAAGAATTAAGG + Intergenic
941175298 2:162191060-162191082 CAGAATCCACGCAAGAATGAAGG - Intronic
941555454 2:166974256-166974278 CACACTGCAAAAAATAATGAAGG + Intronic
943378024 2:187105035-187105057 ATCAATACACATAACAATGAGGG - Intergenic
943422852 2:187690594-187690616 AAAAAAAGACAAAAGAATGATGG - Intergenic
943600979 2:189920660-189920682 CACAAGACACAGAAGAAAGTGGG - Intronic
943698535 2:190963263-190963285 CACAAAACACAAATAAATCATGG - Exonic
943763262 2:191632312-191632334 TACAATCCAAAGAAGAATGAGGG - Intergenic
944112289 2:196145487-196145509 CTCAAGACAAAAATGAATGAAGG + Intronic
944330479 2:198459995-198460017 TACAATAAACAAAAGAAAGCTGG - Intronic
945691236 2:213038670-213038692 CACAACACTCAAAAGAAGAAGGG + Intronic
947027967 2:225760325-225760347 CACAAAACACATAAAAATGCTGG + Intergenic
949058147 2:241940588-241940610 CACAGTATTAAAAAGAATGAGGG + Intergenic
1169240979 20:3980626-3980648 CAGAGTATACAAAAAAATGATGG + Intronic
1170799017 20:19575088-19575110 AAAAATACAAAAAAAAATGAAGG + Intronic
1171559387 20:26109213-26109235 CTGAATACAAAAAAGAATGAAGG + Intergenic
1172041129 20:32046789-32046811 TACAATACACAAAAGCCTCAAGG - Intergenic
1172202127 20:33133763-33133785 CATAATATACAAAAGACCGAGGG - Intergenic
1173865511 20:46309845-46309867 CAAAATAAATAAATGAATGATGG - Intergenic
1174566169 20:51466049-51466071 CAAAACAAACAAAAGAATTAGGG - Intronic
1174740247 20:53005996-53006018 CACAAAAAAGAAAAGAATGAAGG - Intronic
1177392026 21:20487644-20487666 CACAATACACAAAATTATATTGG + Intergenic
1178185991 21:30221123-30221145 GGCAATACAGAAAAGAATGTGGG - Intergenic
1178210695 21:30528334-30528356 CACAATCAACAAAATAATGAAGG + Intergenic
1178269987 21:31180925-31180947 GCCAATGGACAAAAGAATGAGGG + Intronic
1178368689 21:32009214-32009236 CACAATAAACAAAAAAATAGAGG + Intronic
1178408130 21:32342008-32342030 AACAATCCACAAGAGCATGAAGG + Intronic
1178572945 21:33757824-33757846 CACAAAAAACAAAAGCAAGAAGG - Intronic
1180260455 21:46665072-46665094 AACAATACAAAAAAAAATTATGG - Intronic
1181503059 22:23330616-23330638 CACTCTTCACAAAAGGATGAGGG + Intergenic
1181653866 22:24278992-24279014 CACTCTTCACAAAAGGATGAGGG + Intronic
1181687565 22:24540149-24540171 CAGGAGACACAACAGAATGAGGG - Intergenic
1182171787 22:28237649-28237671 CAAAATACATGAAAAAATGAGGG + Intronic
1182438751 22:30348731-30348753 CAAACCACACATAAGAATGAAGG + Intronic
949369276 3:3317415-3317437 GGCAATTCACAAAAGAAAGAGGG + Intergenic
951030178 3:17872790-17872812 TACAATAAACATAAGAATGAAGG + Intronic
952984663 3:38768294-38768316 CACAATAAAAAAAGGAATTAAGG - Intronic
955914720 3:63895171-63895193 CACAATAAACGAAAGAAAAAAGG - Intronic
956533340 3:70246677-70246699 CACAATACTAAAAAAAATTATGG + Intergenic
956662333 3:71611401-71611423 GACAGTACATAAATGAATGAGGG - Intergenic
959304644 3:104645799-104645821 AATAATACACATAAGAATAAAGG + Intergenic
959962341 3:112312777-112312799 CACACTTCACAAAAGAAGGTGGG - Intergenic
960125840 3:113997578-113997600 CAAAAAACACAAAATAATGGGGG + Intronic
960377358 3:116919703-116919725 CACAATACACACAAGTACAATGG + Intronic
962110371 3:132439499-132439521 AAGAAAACACAAAAGAATTAAGG - Intronic
962191451 3:133315353-133315375 CAAAATGCACAAAAGATTGGAGG - Intronic
962277664 3:134028616-134028638 CAGATTACACAAAGGGATGATGG - Intronic
964184630 3:153927944-153927966 CACAATACAAAGAACAATGCTGG + Intergenic
964456298 3:156870943-156870965 AATAATAAAAAAAAGAATGAAGG - Intronic
964508188 3:157422078-157422100 CTCAACACACTAAAGAATCAAGG - Intronic
964521850 3:157578452-157578474 CAAAAGACACAAAAGAGTTAAGG - Intronic
964764388 3:160165105-160165127 CAAAATAAAAAAAAGATTGAAGG + Intergenic
965580848 3:170266125-170266147 GACAATATATAAAATAATGATGG + Intronic
965631802 3:170740817-170740839 CACTATATACAAAGGAAAGAAGG + Intronic
966839758 3:184078870-184078892 CACAAGTCACAAAAGAAGGGTGG - Intergenic
966864897 3:184252640-184252662 GACAATACAAAAGTGAATGATGG + Intronic
968315275 3:197718771-197718793 CACAATATACAAAAAGATGAAGG + Intronic
968386552 4:144230-144252 CAAAATACACAAAGCAAGGAAGG - Intronic
969192862 4:5536482-5536504 CACAATACATTAAAGAGTTATGG + Intergenic
970031676 4:11683219-11683241 CACAAGACTCAAAAGAAGCAGGG + Intergenic
970297868 4:14650533-14650555 CACAAAAGCCAAAAGAATGTAGG + Intergenic
970640574 4:18061134-18061156 ATCCACACACAAAAGAATGAAGG - Intergenic
970733227 4:19133598-19133620 CATAATATACAAAAGAATTAAGG + Intergenic
971089546 4:23324881-23324903 CCCAGGACACAAAAGGATGAGGG - Intergenic
971487775 4:27177553-27177575 CACAATACAAAAAAAAAGGAGGG - Intergenic
971885591 4:32443276-32443298 TACTATACACAAAGCAATGAAGG - Intergenic
972720934 4:41697396-41697418 CAGTATACACAAAAGAATATGGG + Exonic
972738911 4:41872770-41872792 CAAAATACACAAGAAAATAAAGG - Intergenic
973277386 4:48324612-48324634 TACAATATACATAAAAATGATGG - Intergenic
973906042 4:55532016-55532038 CACAATACAAAAATCAATTAGGG + Intronic
974096022 4:57365191-57365213 CACAATAGAAAAAAGAACAAAGG + Intergenic
974189606 4:58488138-58488160 CAAAATGCACAAAACAAGGAAGG + Intergenic
974195343 4:58567279-58567301 GACAAAACAAAAAAGAAGGAAGG - Intergenic
974207341 4:58723096-58723118 CTCAATACACAAAAGAAACAAGG + Intergenic
974247631 4:59341166-59341188 AATTATAGACAAAAGAATGATGG - Intergenic
974248650 4:59356959-59356981 CTCAATACACTAAATATTGAAGG - Intergenic
974258458 4:59492774-59492796 AACAATTCACAGAAGAAAGAGGG - Intergenic
975111724 4:70635770-70635792 AAGAATACATAAAAAAATGAAGG - Intronic
975120206 4:70720068-70720090 CAAAATAAAAAAAAGAAGGAGGG - Intronic
975350912 4:73345135-73345157 CAAAATAAAGAAAAGAAGGATGG + Intergenic
975939224 4:79621416-79621438 TACAATACTCAAATAAATGATGG + Intergenic
975953498 4:79805420-79805442 CATAATCCAAAAATGAATGATGG - Intergenic
976454663 4:85232483-85232505 CAGAATACACAAAATACTGAGGG - Intergenic
976733594 4:88288052-88288074 CACAATGTACAAAATAATCAAGG + Intergenic
976902517 4:90196472-90196494 CAAAATACACAAGAGTATAAGGG + Intronic
977207069 4:94175212-94175234 CACAATACACAAAATTCAGAAGG + Intergenic
977249342 4:94672099-94672121 CACAATAAACTAAACCATGAAGG + Intergenic
977262087 4:94809619-94809641 CAATGTACACAAAAGAAAGAGGG - Intronic
977471596 4:97450267-97450289 CAGAATAAATAAAAGAAGGAGGG - Intronic
977857918 4:101917286-101917308 AATAAAACACAAATGAATGATGG - Intronic
978263238 4:106789134-106789156 CACAACACACAGAACATTGAGGG - Intergenic
978840040 4:113201037-113201059 AATAATAAACAAAAGAGTGAAGG + Intronic
978879873 4:113688942-113688964 CACACTAAAAAAAAAAATGATGG + Intronic
979271682 4:118769674-118769696 CACAATACTCAAAAGAATCGGGG + Intronic
979570508 4:122218132-122218154 GACAAGACAAAAAAAAATGATGG - Intronic
979734706 4:124068991-124069013 CACAATGAACAAAAGAATGTTGG + Intergenic
979749841 4:124265262-124265284 CAAAATACAAAACAAAATGAAGG - Intergenic
979777689 4:124611847-124611869 TAAAATACTCAAAAGAATGTGGG + Intergenic
980533909 4:134090266-134090288 CACAAGACACCAAACAATTAAGG - Intergenic
980616139 4:135228283-135228305 CACAATATTCAAATCAATGAGGG + Intergenic
980665521 4:135928775-135928797 AATAATGCACAAAAGCATGATGG - Intergenic
981142698 4:141288113-141288135 TACATTGCACAACAGAATGAAGG - Intergenic
981271365 4:142849838-142849860 CACAAAAGACAAAAGAAAGTAGG + Intergenic
981436293 4:144726886-144726908 CACACAAAACAAAATAATGATGG - Intronic
981979830 4:150777657-150777679 CACATTACACACAAGACTAAAGG + Intronic
982080131 4:151781419-151781441 CAAAAAACAAAAAAAAATGAGGG + Intergenic
982198852 4:152940066-152940088 GAGAATACACAAAAGAACGATGG - Intronic
982270070 4:153577420-153577442 AAAACTACACAAAAAAATGATGG - Intronic
983484887 4:168321751-168321773 CACAACAAACTGAAGAATGATGG - Intergenic
983607058 4:169599307-169599329 GACCATACTCAAAAGAATTAGGG + Intronic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984142293 4:176018737-176018759 CTCAATATACAAAAGAATAGTGG - Intergenic
984942740 4:184948726-184948748 GAAAATACACAGAAGAATTAAGG + Intergenic
986529652 5:8723083-8723105 AACAATACAGAAAACCATGATGG - Intergenic
986719976 5:10553895-10553917 CCCAATACACAGAAAAATGCTGG + Intergenic
987455278 5:18137753-18137775 CCCACAACACAAAAGAATTATGG + Intergenic
989577702 5:43003922-43003944 CACAAAAGCCAAAAAAATGAAGG + Intergenic
989967435 5:50481643-50481665 AACAATACATAAATGAATTAAGG + Intergenic
991201552 5:63999980-64000002 AACAATTCACAAAAGGATTATGG + Intergenic
991329243 5:65475404-65475426 CAGAATACAGAAAAGGATTAAGG + Intronic
992227157 5:74630018-74630040 AACAAAACAAAAAAGCATGAAGG + Intronic
993403928 5:87487942-87487964 TACAAGACAGAAGAGAATGAGGG - Intergenic
993759154 5:91770328-91770350 CAAAATACACAAAAGACATAGGG - Intergenic
994611073 5:102040356-102040378 CTCTATACACACAAGGATGATGG + Intergenic
995264351 5:110140110-110140132 CAAAATATAGAAATGAATGACGG + Intergenic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
996333707 5:122360113-122360135 CAAAATCCAAAAAAGAATGCTGG - Intronic
996701925 5:126458444-126458466 CAAAAAAAAAAAAAGAATGAGGG + Intronic
998568468 5:143236628-143236650 CCCAATAAATAATAGAATGAAGG - Intergenic
1000310553 5:160039886-160039908 CACAATAAACAAAACAAAAAAGG - Intronic
1000497151 5:161998844-161998866 AGGAATACACAAGAGAATGAAGG - Intergenic
1000659900 5:163925031-163925053 AACATTACACAAAAGTTTGAAGG - Intergenic
1001376252 5:171261425-171261447 CACAACACAAAGGAGAATGAAGG - Intronic
1001437436 5:171710986-171711008 CACAATAGAGAGAAGAATAAGGG + Intergenic
1001856856 5:175020102-175020124 AACAATACACAAAGAAATAATGG - Intergenic
1002325661 5:178403938-178403960 CAAAAGCCTCAAAAGAATGACGG + Intronic
1003186770 6:3838867-3838889 CACAAGAAAAAAAAGAATGAAGG + Intergenic
1004044951 6:12013817-12013839 AATAATACAAAAAAAAATGATGG - Intronic
1004761241 6:18669002-18669024 CTCCATACACCAAAGAATAAAGG - Intergenic
1004762654 6:18687108-18687130 CAAAATATTCAAAAAAATGATGG - Intergenic
1005677477 6:28169905-28169927 CACATGATACAGAAGAATGAGGG + Intergenic
1008988793 6:57578656-57578678 AACAAAAAACAAAAGAAGGAAGG - Intronic
1009035205 6:58109382-58109404 CACAAGACAAAAACGAATAAAGG + Intergenic
1009210719 6:60860099-60860121 CACAAGACAAAAATGAATAAAGG + Intergenic
1009252954 6:61331606-61331628 CACACAACACAAAAAAGTGACGG - Intergenic
1009257640 6:61433427-61433449 CACACAACACAAAAAAGTGACGG - Intergenic
1010011978 6:71058492-71058514 CAGAATACACATAAAAATCATGG + Intergenic
1010453049 6:76025001-76025023 GAAAATACAGAAAAGAATAAAGG - Intronic
1012283052 6:97352763-97352785 CATAATACACCAATGAATGCAGG - Intergenic
1012473962 6:99601635-99601657 AACACTGAACAAAAGAATGAGGG - Intergenic
1012729239 6:102859518-102859540 CACAATAAAAAACAGAATAAAGG + Intergenic
1013017270 6:106171428-106171450 CACAAAACACAAATGAATTTTGG + Intergenic
1013702543 6:112790749-112790771 CAAAAAACAAAAAAGAATGTAGG - Intergenic
1013990817 6:116252550-116252572 CACAATGCAGAAAAGCATGAAGG + Exonic
1014134211 6:117868827-117868849 CACAATGCACAAGAAAGTGAAGG - Intergenic
1015648531 6:135424844-135424866 CAAAAAACACAAAAGACTTAAGG - Intronic
1016041038 6:139432135-139432157 CCCAAAACAGAAAGGAATGAGGG - Intergenic
1017144121 6:151218315-151218337 CACAATAAAAAAAAGAGTGAAGG - Intergenic
1017602035 6:156093982-156094004 GAAAAGACAGAAAAGAATGAGGG - Intergenic
1020414452 7:7929977-7929999 AACAATACATAATTGAATGAGGG - Intronic
1020713845 7:11644078-11644100 CACAATACACAAAAGAATGAAGG - Intronic
1020978241 7:15034883-15034905 CACAATAAACAAATGAATAATGG + Intergenic
1022021688 7:26405754-26405776 CACCTTGCCCAAAAGAATGAAGG + Intergenic
1022126279 7:27360766-27360788 CACAATATAAAAATGAATGGTGG + Intergenic
1022752262 7:33241953-33241975 TACAATACACAAAAAATTGAAGG - Intronic
1023070992 7:36433448-36433470 AAAAAAACAGAAAAGAATGATGG - Intronic
1023678424 7:42655754-42655776 AACAATACCCAAAAGAATCAAGG + Intergenic
1024409360 7:49022047-49022069 CACAATAATAAAAAGAATGTTGG + Intergenic
1025041370 7:55648877-55648899 CACAATTCACATAACCATGACGG + Intergenic
1025554306 7:62285335-62285357 AAAAATACACAAAAGACTAATGG - Intergenic
1025560475 7:62367939-62367961 AAAAATACACAAAAGACTAATGG + Intergenic
1026234822 7:68518039-68518061 CACAAAAAAAAAATGAATGAAGG + Intergenic
1026357777 7:69574433-69574455 CCCAATAGATGAAAGAATGAGGG + Intergenic
1027482224 7:78712613-78712635 CAAAATATACAAAAGAGTAAAGG + Intronic
1027482712 7:78718655-78718677 CACAATGCACCATAGAATCAAGG - Intronic
1027491229 7:78829062-78829084 CAAAATACACAAAAATATGAAGG - Intronic
1027799278 7:82732045-82732067 AACAATGCCCAAAAGAATGAAGG - Intergenic
1028027095 7:85857504-85857526 CCCACAACACATAAGAATGATGG - Intergenic
1028266412 7:88732201-88732223 CAGAAGACACAAAAGAAAAAAGG - Intergenic
1028280329 7:88917727-88917749 TATAATACACAAAAGAGGGATGG + Intronic
1028374606 7:90133316-90133338 AACAATACACGAATGAATGTAGG + Intergenic
1028622995 7:92845140-92845162 CACAAGAGATAAAAGAAAGATGG + Intergenic
1030150536 7:106399916-106399938 TATAAGACACAAAAGAATAAAGG + Intergenic
1031212255 7:118845602-118845624 GACATTATACAAAACAATGAAGG - Intergenic
1031284800 7:119853710-119853732 CACAATAAAAAAATTAATGAGGG + Intergenic
1031310684 7:120193714-120193736 CAAAATACAAAAAAAATTGAGGG + Intergenic
1031873514 7:127112375-127112397 CAGAATACACAAATTAATGCAGG - Intronic
1033770986 7:144551385-144551407 CAAAATACACACAAATATGAAGG + Intronic
1033809184 7:144990813-144990835 CACAAAAGACAATAGAATGATGG + Intergenic
1034186548 7:149182211-149182233 CACAATTCAAATACGAATGAAGG + Intronic
1034714919 7:153233327-153233349 CACAAGCCAGAAGAGAATGAGGG - Intergenic
1035441529 7:158905543-158905565 CACGAAACAAAAGAGAATGAAGG - Intronic
1035744678 8:1953177-1953199 TAAAATACAGAAAGGAATGACGG - Intronic
1035744690 8:1953275-1953297 TAAAATACAGAAAGGAATGACGG - Intronic
1036087735 8:5631679-5631701 AACAAAACCTAAAAGAATGACGG - Intergenic
1036293719 8:7518105-7518127 CAAAAGACACAAAAGCATGGCGG - Intergenic
1036328842 8:7802890-7802912 CAAAAGACACAAAAGCATGGCGG + Intergenic
1037001017 8:13718840-13718862 CCCCACACACAACAGAATGATGG - Intergenic
1038597430 8:28901344-28901366 AACAAGAGAGAAAAGAATGATGG - Intronic
1038607977 8:29029224-29029246 AACATTATACAAAATAATGAAGG - Intronic
1039683741 8:39772592-39772614 CAGAAAACACAAAGGAATAATGG - Intronic
1039708028 8:40027034-40027056 CACAATAAGCACAAGAAGGACGG + Intergenic
1039780666 8:40781854-40781876 CACAATTCAACAAATAATGATGG + Intronic
1042267447 8:66923939-66923961 CACAAAACCCAAAAGACTGATGG + Intergenic
1042504272 8:69542911-69542933 CACATTACACAGAATAATGGGGG + Intronic
1042923489 8:73942729-73942751 CACAACACACAAAAGATTAATGG + Intronic
1042932227 8:74024986-74025008 CAAAATATATAAAAGAAAGATGG - Intronic
1043093905 8:75940658-75940680 CAAAGGACACAAAAGAATCAGGG + Intergenic
1045756064 8:105543736-105543758 TTGAATACACAAAAGAAGGAAGG - Intronic
1045864080 8:106844950-106844972 CACAAAAAACAAAAAAAAGATGG + Intergenic
1046172589 8:110530344-110530366 GGCAATTTACAAAAGAATGAGGG - Intergenic
1046177499 8:110597399-110597421 CAAAAGATACAAAAGAAAGAAGG + Intergenic
1046481394 8:114822880-114822902 CACAATATACAAAAAAGTGTGGG + Intergenic
1046956200 8:120065232-120065254 CACAACACATCCAAGAATGAAGG - Intronic
1047321772 8:123792750-123792772 CCCAAAACACAAAAGAGTGAAGG - Intronic
1047867239 8:129039518-129039540 GAAAATATACTAAAGAATGAAGG - Intergenic
1048858171 8:138701412-138701434 CACAATACATTAAAAAAAGATGG + Intronic
1050139406 9:2501978-2502000 CAAAATGCACAAAACAAGGAAGG + Intergenic
1050846977 9:10233336-10233358 CAGAGAACACAAAACAATGAAGG - Intronic
1051063534 9:13073972-13073994 AAAATTACACAAAAGAATGAAGG + Intergenic
1051086479 9:13355216-13355238 CACACTGCACAATTGAATGATGG + Intergenic
1051169213 9:14301887-14301909 CACAATTCACAAGATAAAGAAGG - Intronic
1052024479 9:23559272-23559294 CAAAATAGAAAAAAGCATGAAGG + Intergenic
1052126930 9:24788357-24788379 CACAATAGACAAGAGATTAAGGG - Intergenic
1052680098 9:31680240-31680262 CAAAACAAACAAAAAAATGAGGG + Intergenic
1053587566 9:39476490-39476512 CACAACACAAAAAAAAATGCTGG + Intergenic
1054801247 9:69351304-69351326 CTAAATACTCAAAAGGATGAAGG - Intronic
1055241731 9:74194412-74194434 TACAATACAGAAAAAAATTATGG - Intergenic
1056190247 9:84177748-84177770 CACATGACACACAAGAATTATGG - Intergenic
1056535370 9:87523064-87523086 CACAACACAAAAAAAAATCATGG - Intronic
1057341302 9:94204311-94204333 CAGAATAGAGAATAGAATGATGG + Intergenic
1057997665 9:99834073-99834095 CACCAGTCACACAAGAATGATGG + Intronic
1059687803 9:116654238-116654260 CACAATAAATAAATGAATGGGGG - Intronic
1060007082 9:120010069-120010091 CTCAGTACACATCAGAATGAAGG - Intergenic
1061175387 9:128992585-128992607 AAAAAGACAAAAAAGAATGAAGG - Intronic
1062652777 9:137586842-137586864 CAAAATACACAGAAGCATCAGGG + Intronic
1185883469 X:3760793-3760815 CACAATAGCCAAAAGATGGAAGG - Intergenic
1186183394 X:6994624-6994646 AAGAATGCAGAAAAGAATGAGGG + Intergenic
1186253437 X:7694071-7694093 CAAAATATAGAAAAGAAAGAGGG + Intergenic
1186632692 X:11367151-11367173 CAGAAGACTCAAAGGAATGATGG + Intronic
1186755794 X:12670208-12670230 AACAGTAAACAAGAGAATGAGGG - Intronic
1187502686 X:19852881-19852903 AACAATAAAAAAAAGAAGGAAGG + Intronic
1188375634 X:29424675-29424697 CCCAAAACACAAAAGGATGTGGG + Intronic
1188894033 X:35644192-35644214 CACAATACCCCAAAGTATGGTGG - Intergenic
1188896156 X:35670944-35670966 CACAAGACTTAGAAGAATGACGG - Intergenic
1189888477 X:45574807-45574829 AACAAAAAACAAAAGCATGAAGG - Intergenic
1190074611 X:47307491-47307513 CAAAATACACTAAAAAAAGATGG - Intergenic
1190971243 X:55350737-55350759 CACATCACATAACAGAATGAAGG - Intergenic
1191911350 X:66153838-66153860 CACAATATAGAAAAAAATAAAGG + Intergenic
1192345696 X:70303050-70303072 AACAATACAAAAAAGAAATAAGG + Intronic
1193022047 X:76801500-76801522 CACAAGACACAAAATAACCACGG + Intergenic
1193440372 X:81533730-81533752 CACAAGCCAGAAAAGATTGAGGG - Intergenic
1193803459 X:85965697-85965719 AACACTACAAAAAAAAATGAGGG + Intronic
1194055160 X:89122911-89122933 GAGATGACACAAAAGAATGAAGG - Intergenic
1194323350 X:92479679-92479701 CACAAGCCAGAAAAGATTGAGGG - Intronic
1194595635 X:95853771-95853793 TACATTATACCAAAGAATGAAGG + Intergenic
1195033192 X:100946590-100946612 CCCAATGCACAAGAGGATGAGGG + Intergenic
1195742536 X:108079745-108079767 CACAAGAAGCAAAATAATGAAGG + Intergenic
1196996475 X:121389244-121389266 CCAAATACACAAAGGAGTGAAGG - Intergenic
1197373308 X:125651037-125651059 CACAATAGAAAACACAATGAAGG - Intergenic
1197458484 X:126708094-126708116 GACAATACAGGAAACAATGAAGG + Intergenic
1197666104 X:129225103-129225125 CACAATAAAAATAAGAAAGAAGG - Intergenic
1199046010 X:143174177-143174199 CAGAACACAGAAAAGAATCAAGG + Intergenic
1199122204 X:144068925-144068947 CACAATCAACAAATGACTGAAGG - Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1199300201 X:146204603-146204625 CACACTACCCAAAACACTGAGGG - Intergenic
1199495462 X:148447467-148447489 CCCAAAGCACAAAAGAAAGAAGG - Intergenic
1200065544 X:153502681-153502703 CTCAAGGCTCAAAAGAATGAGGG + Intronic
1200584370 Y:4989633-4989655 CATAGAACTCAAAAGAATGATGG + Intergenic
1200631451 Y:5592839-5592861 CACAAGCCAGAAAAGATTGAGGG - Intronic
1200745095 Y:6897214-6897236 CATGATGCACAGAAGAATGATGG + Intergenic
1200801640 Y:7392560-7392582 CACATCAAACAAAGGAATGAAGG - Intergenic
1201470276 Y:14325701-14325723 CAAAATATAGAAAAGAAAGAGGG + Intergenic
1201483933 Y:14471792-14471814 CTCAAAATACAAAAGAATGTGGG + Intergenic