ID: 1020715686

View in Genome Browser
Species Human (GRCh38)
Location 7:11673147-11673169
Sequence GGTGCTCAGTGACTCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020715686_1020715691 3 Left 1020715686 7:11673147-11673169 CCTGCCTGGAGTCACTGAGCACC 0: 1
1: 1
2: 4
3: 27
4: 265
Right 1020715691 7:11673173-11673195 ACTGGCCCCTGCACCCAGATTGG No data
1020715686_1020715695 11 Left 1020715686 7:11673147-11673169 CCTGCCTGGAGTCACTGAGCACC 0: 1
1: 1
2: 4
3: 27
4: 265
Right 1020715695 7:11673181-11673203 CTGCACCCAGATTGGACGTAAGG No data
1020715686_1020715698 17 Left 1020715686 7:11673147-11673169 CCTGCCTGGAGTCACTGAGCACC 0: 1
1: 1
2: 4
3: 27
4: 265
Right 1020715698 7:11673187-11673209 CCAGATTGGACGTAAGGAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020715686 Original CRISPR GGTGCTCAGTGACTCCAGGC AGG (reversed) Intronic
900305067 1:2001973-2001995 AGTGCAAAGTGACTCTAGGCTGG + Intronic
900439129 1:2644628-2644650 GGTGCACCGTGATTCCAGGCAGG + Intronic
901638027 1:10679431-10679453 GGTGAACAATGACTCCAGCCTGG - Intronic
902565347 1:17307883-17307905 GGTGTTCAGGGCCTCTAGGCAGG + Intergenic
903822013 1:26110791-26110813 GGTCCTAAGTGACCCCGGGCTGG + Intergenic
905909753 1:41645720-41645742 GGTGCTCAGTAAATACATGCTGG + Intronic
906537800 1:46561459-46561481 GGGGGTGAGTGACTCCAGGGAGG - Exonic
907945435 1:59131969-59131991 GGTGCACAGTGACAACAGGTTGG + Intergenic
909412622 1:75373288-75373310 GGTGCTCGGTGACTCCATGCAGG - Intronic
913174515 1:116261959-116261981 GGTACTCTGAGACTCAAGGCTGG + Intergenic
913505535 1:119513249-119513271 CTTGCTCAGTGACTCCAGGATGG + Intronic
914821678 1:151109386-151109408 CTTGCTCTGTCACTCCAGGCTGG + Intronic
915303202 1:154963104-154963126 CTTGCTCAGTGCCTCCTGGCCGG - Exonic
915318982 1:155045775-155045797 GGTGCTCAATGAATGCTGGCTGG + Intronic
915327704 1:155089349-155089371 GGTGCTCAGTGAATGGAAGCTGG - Intergenic
917394034 1:174572413-174572435 CTTGCTCAGTCACCCCAGGCTGG + Intronic
920386993 1:205576300-205576322 GGTGCTCACTGCCTCCCTGCTGG - Intronic
920845202 1:209587886-209587908 TGTGCTCTCTGCCTCCAGGCTGG - Intronic
922803801 1:228375663-228375685 AATGGTCAGTGACTCCAGGGTGG - Intronic
923408101 1:233683031-233683053 TGTGCTCAGTGATGCCAGACTGG + Intergenic
924029225 1:239869569-239869591 TGTGATCTGTGACTCCAGGCTGG - Intronic
1063133731 10:3199120-3199142 CGTGCACAGAGACACCAGGCTGG + Intergenic
1063969408 10:11371116-11371138 GGTTCTCCGTGACTGCAGCCTGG + Intergenic
1064595753 10:16943059-16943081 GGTGGTCAGAGCCTCCAGGCTGG - Intronic
1070708324 10:78657712-78657734 GGTGCTCAGTGTCTCCTGGCAGG - Intergenic
1070789234 10:79179863-79179885 GGTGAGCAGGCACTCCAGGCAGG + Intronic
1071005497 10:80879754-80879776 GTTCCTCACTGACTCCTGGCTGG + Intergenic
1073086522 10:100894128-100894150 GGCACTCAGTGACATCAGGCTGG - Intergenic
1073430239 10:103481075-103481097 GGTGCTGAGTGACTGCAGCGGGG + Intergenic
1074415648 10:113264723-113264745 GGGGCTCAGGGAGACCAGGCAGG - Intergenic
1075664942 10:124223408-124223430 ACTGCTTTGTGACTCCAGGCAGG - Intergenic
1076243843 10:128931060-128931082 TTTGCTCAGTGTCTGCAGGCTGG + Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1076888080 10:133271668-133271690 GATGTTCAGTGACTGCAGCCAGG - Exonic
1076898794 10:133327010-133327032 GGGGCTCAGCCACGCCAGGCAGG + Intronic
1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG + Intergenic
1078855278 11:15201644-15201666 GGCTCTCAGGGACTCCAGCCAGG + Intronic
1079181407 11:18196948-18196970 GGTTCTCTGTGAGTCCAGCCTGG + Intronic
1079791797 11:24748158-24748180 GGTTCTCTGTGATGCCAGGCAGG + Intronic
1079869518 11:25780558-25780580 GGTTCTCAGTGACTAGAGACTGG + Intergenic
1083171794 11:60927646-60927668 GGGGCTCAGTGACTCGAGGGGGG - Exonic
1083222112 11:61259214-61259236 GGGCCTCAGTGTCTCCATGCAGG + Exonic
1083369366 11:62166158-62166180 TTTGCTAAGTGACTCCAGGCAGG - Intergenic
1083803569 11:65060301-65060323 TGTGATCAGTGACTTCAGGGAGG + Intergenic
1085731259 11:79001358-79001380 GGTGCTCAGTAGCCCCATGCAGG - Intronic
1086161059 11:83722561-83722583 GGTGGGGAGTGACTCCAGGCTGG + Intronic
1088229519 11:107659620-107659642 GGTGCTCAGTAACTAGAGGGGGG + Intronic
1088774018 11:113064295-113064317 GTTTCTCAGTGCCTCCAGGCAGG + Intronic
1090303799 11:125672783-125672805 GATGCTCAGTGTCTCCATGCAGG + Intronic
1090729400 11:129557238-129557260 TGCACTCAGTGACTCCACGCAGG - Intergenic
1091141186 11:133236225-133236247 GCTGCTAATTGACACCAGGCAGG + Intronic
1092003622 12:5050770-5050792 GGAGTTGAGTCACTCCAGGCTGG - Intergenic
1094299834 12:28950678-28950700 GGTTGTCAGTGGCTGCAGGCAGG - Intergenic
1095259579 12:40082885-40082907 GGTGCTCAGCAACTCCATGCAGG + Intronic
1096242419 12:49966525-49966547 GGTAGTTACTGACTCCAGGCTGG - Intergenic
1096764625 12:53874194-53874216 GAAGCTCAGTGACCCTAGGCTGG + Intergenic
1097104061 12:56610312-56610334 TGGGCTCAGTGACAACAGGCTGG - Intronic
1098393326 12:69992388-69992410 TGTGCTCAATGACTCCAGCTTGG + Intergenic
1098943164 12:76559927-76559949 GGTGGACAGTGACTCCCGCCCGG - Intergenic
1099730609 12:86495523-86495545 GGTGTTCTGTGTGTCCAGGCTGG + Intronic
1099997978 12:89800030-89800052 GGTGCTCAGCTACTTTAGGCAGG - Intergenic
1102543158 12:113636924-113636946 GGCGCTCAATGAGGCCAGGCTGG - Intergenic
1103232214 12:119340856-119340878 GGTAATCAGTGATTCCATGCAGG - Intronic
1104463137 12:128970924-128970946 GGTGCTCAGTGAGTACTGGAAGG + Intronic
1104937670 12:132375197-132375219 GGTGCTCAGTGGACCCTGGCCGG + Intergenic
1105417697 13:20227548-20227570 GGTGCTCAGTGACCCTGAGCTGG + Intronic
1107447794 13:40483843-40483865 GGTGCTCAGTGCTTACTGGCAGG - Intergenic
1107731633 13:43355092-43355114 AGTGCTCAGTGACCTCAGGAGGG + Intronic
1108424980 13:50290557-50290579 GGTGATCAGGGACACCAGCCAGG - Intronic
1109143311 13:58744460-58744482 CATTCTCAGTGACTCCATGCTGG + Intergenic
1112335973 13:98516381-98516403 GGTGCTGATGGCCTCCAGGCAGG - Intronic
1114271616 14:21103739-21103761 TGTGCTGAGTGACGCGAGGCGGG + Intronic
1116282769 14:42929334-42929356 GGTGCTCAGTAGCTCCATGCAGG + Intergenic
1117835869 14:59805410-59805432 GGTTCTCAGGTGCTCCAGGCTGG - Intronic
1118334815 14:64843869-64843891 GGTGCTTAGAGAGTCCAGTCAGG - Intronic
1119682563 14:76603834-76603856 GGTGGTAAGTGTCTCCAGGCAGG + Intergenic
1120112357 14:80572619-80572641 GGTGCCCACTGACTCGAGACTGG + Intronic
1121717059 14:96083926-96083948 GGTGCCGAGTGCCTCCTGGCAGG + Intronic
1121717213 14:96084832-96084854 GGTGCCGAGTGCCTCCTGGCAGG + Intronic
1121776611 14:96594949-96594971 GGTGCCCAGGGACTCCGGGGTGG + Intergenic
1122610815 14:102982059-102982081 GGCACTCAGTGACTGCTGGCAGG + Intronic
1124167184 15:27338616-27338638 GGTGCTCAGTGCCCCCAGGGAGG + Intronic
1124240906 15:28026993-28027015 GGCGCTCAGCGACTTCAGGTCGG + Intronic
1124395528 15:29297765-29297787 GGTAATCAGTGAATCCATGCGGG + Intronic
1124721589 15:32115444-32115466 GCTGCACAGTGTGTCCAGGCAGG - Intronic
1125475785 15:40047350-40047372 GCAGCTCAGTGTCTCCATGCAGG + Intergenic
1127956975 15:63862386-63862408 GGGGCTCACTGAATTCAGGCAGG - Intergenic
1128744110 15:70101726-70101748 GCTGCTCTGTAAATCCAGGCCGG - Intergenic
1129603483 15:77013549-77013571 AGTGGTCAGGGACTCCAGGGGGG - Intronic
1129844763 15:78763181-78763203 GCTGCTGAGTGACTCTGGGCAGG - Intronic
1130257058 15:82330672-82330694 GCTGCTGAGTGACTCTGGGCAGG + Intergenic
1130546112 15:84858346-84858368 GGTCCCCAGGGACTCCAGGGCGG + Exonic
1130597892 15:85259318-85259340 GCTGCTGAGTGACTCTGGGCAGG - Intergenic
1132003962 15:98209068-98209090 GAAGTTCAGTGACTCCAGGATGG - Intergenic
1132380437 15:101362430-101362452 GGTGCTCAGTGTCACGGGGCTGG + Intronic
1134248101 16:12555023-12555045 GCTGCTCGGTGGCACCAGGCAGG - Intronic
1134248235 16:12555767-12555789 GCTGCTCAGTGGCACCAGGCAGG + Intronic
1135324762 16:21519466-21519488 GTTGCTCAGTTACTCCACGTGGG + Intergenic
1135823681 16:25707069-25707091 GCTGCTGAGTGACTCAAGGATGG - Intronic
1136336248 16:29612741-29612763 GTTGCTCAGTTACTCCACGTGGG + Intergenic
1137028335 16:35499859-35499881 GGTGATGAGAAACTCCAGGCTGG - Intergenic
1138417451 16:56879507-56879529 GGGGCTCAGGGACTCCACGGTGG - Intronic
1140213695 16:72990569-72990591 GGTGCTCAGCTCCTCCAGGGTGG - Intronic
1140512694 16:75519547-75519569 GGTGCTCCTTAACTCCAGCCTGG + Intergenic
1141203240 16:81913451-81913473 GAGGCTGTGTGACTCCAGGCAGG - Intronic
1141237700 16:82234135-82234157 GATGCTCATTGACTTCAAGCTGG - Intergenic
1141746820 16:85931566-85931588 GGTGTTCAGTGCCCCCAGGGTGG + Intergenic
1141756525 16:85994995-85995017 GGTGCTCAGTGGATCCTGTCAGG + Intergenic
1141760148 16:86022836-86022858 GGAGCTCAGTGGCTCCAGAGGGG + Intergenic
1141847618 16:86621689-86621711 CGTGCTCAGTGACTCCTCCCAGG - Intergenic
1144044432 17:11442275-11442297 GGTGCTCACTGACTCCAGGCAGG - Intronic
1144810394 17:17995082-17995104 GGAGCTCACCGACACCAGGCAGG - Exonic
1144853120 17:18254086-18254108 GTTGCTCAGACCCTCCAGGCTGG + Exonic
1144951994 17:18999410-18999432 GGTGCTCAGGGCCTGCAGACTGG + Intronic
1146936923 17:36817819-36817841 TCAGCTCAGTGACTCCAGCCTGG + Intergenic
1147462308 17:40581153-40581175 GGTGCTCAGTGAATGGATGCTGG - Intergenic
1148187863 17:45657557-45657579 GGTGCTTGGTGAATCCAGCCAGG + Intergenic
1149189241 17:54038788-54038810 GGTGCTAAGAGACTGCAGACAGG + Intergenic
1150624995 17:66835781-66835803 TCTGCTCAGTGGCTCCTGGCAGG - Intronic
1151511444 17:74563055-74563077 GATGCTCTGTTACTCCAGTCAGG - Intergenic
1151705041 17:75763009-75763031 GCTGCTCATTGACTGCAGGTTGG - Exonic
1152118988 17:78406614-78406636 GGTGGTCAGTGTCTCAGGGCAGG + Intronic
1153325699 18:3817972-3817994 GGTCCTCATTGATTTCAGGCTGG + Intronic
1153450839 18:5226455-5226477 GGTCCTCATTGATTTCAGGCTGG - Intergenic
1154141956 18:11831863-11831885 GCTGCTCAGTGCCACCTGGCTGG - Intronic
1157558566 18:48630178-48630200 TCTGCTCAGTGACTCTGGGCTGG - Intronic
1159944686 18:74435500-74435522 GGTCTGCATTGACTCCAGGCAGG - Exonic
1160832455 19:1110140-1110162 GGTGCTGGGTGACCCCAAGCAGG + Intronic
1161294369 19:3512234-3512256 GGTGCTCAGTGGATGCTGGCTGG - Intronic
1161506863 19:4648732-4648754 GGAGCTCCGTGACCCCAGGCAGG - Intronic
1161933301 19:7355639-7355661 GGTGCTCAACCACTCCTGGCCGG + Intronic
1162005545 19:7776246-7776268 GGTGCTCAGTTACTGCCGCCAGG + Intergenic
1162464627 19:10832399-10832421 GGGGCTCAGGGACACCAGCCAGG - Intronic
1162966327 19:14157848-14157870 GGTGCTCTGCTCCTCCAGGCAGG - Intronic
1163222005 19:15928643-15928665 GATGCTGAGTGACTCTGGGCAGG - Intronic
1163225662 19:15959373-15959395 GATGTTCATTGACTCCAGGTGGG + Intergenic
1163862775 19:19750790-19750812 GGTGATCTATGACTCCAAGCTGG + Intergenic
1164848119 19:31451822-31451844 GGTGCACAGTGTCTACAGCCTGG + Intergenic
1165061786 19:33208373-33208395 AGAGCTCAGGGGCTCCAGGCTGG - Exonic
1165882846 19:39055758-39055780 AGTGATCTGTGACTCCAGCCTGG - Intergenic
1166455999 19:42939774-42939796 AGTGTTCAGTGAGCCCAGGCAGG - Intronic
1166492696 19:43272107-43272129 AGTGGTCAGTGACCCCATGCAGG - Intergenic
1166588202 19:43969714-43969736 GGTCTTCAGTCACTCCAGCCAGG + Intronic
1166719315 19:44988269-44988291 GGGGCTGAGAGACCCCAGGCAGG - Intronic
1168413316 19:56153606-56153628 GATGCTGAGTGACTACAGCCAGG - Intronic
925028312 2:626949-626971 AGTGCTAATTGACTCCATGCAGG - Intergenic
926104484 2:10141812-10141834 AGGGCTCAGTGACTGCATGCTGG - Intronic
926276162 2:11404817-11404839 GATGCTCAGTGGCTTCAGCCAGG - Intergenic
926582824 2:14649704-14649726 GGTGCACTGTGAGTCCACGCAGG - Intronic
928127741 2:28627984-28628006 GGTGCTCAGTAAGTCCTTGCAGG - Intronic
929775379 2:44928309-44928331 GGCTCTAAGTGACTCCAGCCCGG - Intergenic
930683120 2:54278934-54278956 GGAGCTCTGTGGCTCCATGCAGG + Intronic
934973970 2:98787421-98787443 GATGCAGAGTGGCTCCAGGCTGG + Intergenic
935028031 2:99296224-99296246 GGGGGTCTGTGATTCCAGGCTGG - Intronic
935173354 2:100627889-100627911 GGTGCTCACAGCCGCCAGGCTGG - Intergenic
937323217 2:120973327-120973349 GGTGCTCAGTGCCTGCCTGCCGG - Intronic
938082917 2:128379788-128379810 GGGGCTCAGTTTCTCCAGGAAGG + Intergenic
938465474 2:131522127-131522149 GGTGCTCAGTGGCTTCTGCCTGG + Intergenic
938584768 2:132679378-132679400 GGGGCCCAGAGACTCCAGGAGGG + Intronic
939998903 2:148947745-148947767 GGAGGTCAGTGCCTCCAGACAGG - Intronic
940856069 2:158729637-158729659 GATGCTCAGTGTGTCCTGGCCGG + Intergenic
941858453 2:170254076-170254098 GGTGCTCAGTGACTCCATGTGGG - Intronic
943288551 2:186038182-186038204 GGTCCTCAGTGTCTCTAGGATGG - Intergenic
945072296 2:206004155-206004177 GGTGCTCATTCCCTCCTGGCAGG - Exonic
945864176 2:215158506-215158528 GGTGGTCAGTGACACTAGGCAGG + Intergenic
947231849 2:227895590-227895612 GCAGCTCAGTGTCTCCAGGAGGG + Intronic
947501242 2:230672755-230672777 AATACTCAGTGAATCCAGGCAGG + Intergenic
947714709 2:232333695-232333717 GTTGCTGAGTGACGCCAGGGAGG - Intronic
1168887921 20:1273034-1273056 GGTGCAGAGAGACTCCTGGCAGG + Intronic
1171376215 20:24695892-24695914 GGTGGTCAGAGACTGGAGGCTGG + Intergenic
1172025149 20:31943355-31943377 GGTGCCCAGTGACTCCAAGTAGG - Exonic
1172135812 20:32686036-32686058 GAGTCTCAGTGTCTCCAGGCAGG - Intergenic
1173202318 20:40963006-40963028 GGTGCTCACTGTTACCAGGCTGG - Intergenic
1173937737 20:46881759-46881781 GGTGCCCAGGGACTCTACGCTGG - Intergenic
1174390288 20:50214695-50214717 GGTGCTCAGTGACTACTGGATGG + Intergenic
1174392556 20:50226844-50226866 CGTGCTCAGTGACCTCAGCCTGG - Intergenic
1175537533 20:59725347-59725369 TGAGCTCAGTGAGTCCAGGTGGG + Intronic
1175871640 20:62212025-62212047 GTTCCTCAGGGACTCAAGGCTGG + Intergenic
1175925631 20:62469997-62470019 GGTGCTGAGTGTGGCCAGGCTGG - Intronic
1175949867 20:62577689-62577711 GGTGCTCAGGGCCTGCAGGGCGG - Intergenic
1179635018 21:42703317-42703339 GGTGCTCACTCACTCCCTGCTGG - Intronic
1180093994 21:45546277-45546299 GGAGCTCCGGGGCTCCAGGCAGG - Intergenic
1180206666 21:46265176-46265198 GAGGCTGAGTGACTCTAGGCAGG + Intronic
1180246649 21:46552990-46553012 GATGCCCAGTGGCTCAAGGCAGG + Intronic
1181003114 22:19997242-19997264 CGAGCCCAGTGACTGCAGGCAGG + Intronic
1181105091 22:20569533-20569555 GGTGCACAGTGCCTCGTGGCAGG + Intronic
1181277578 22:21696280-21696302 GGGGCACAGAGACGCCAGGCAGG - Intronic
1181803986 22:25364242-25364264 GGTGTTTACTGACTCCAGGGAGG + Intronic
1182097921 22:27638427-27638449 GATGCTCAGGGACCCCTGGCTGG + Intergenic
1183538988 22:38418819-38418841 GGTGCTCAGGGACCCCAGGATGG - Intergenic
1184790894 22:46699226-46699248 GGTGCTCAGTGGATTCAGTCAGG + Intronic
1184975266 22:48057346-48057368 GGTGCTCAGGAACTCCTGTCGGG - Intergenic
1185100232 22:48836424-48836446 AGTGCTCAGTGCCCGCAGGCAGG - Intronic
1185141874 22:49107019-49107041 GGAGCCCAGTGTCTCCAGGAGGG - Intergenic
949661353 3:6283118-6283140 GGTGCTCAGCGACCCCGTGCAGG - Intergenic
950529606 3:13545604-13545626 GGTCATCAGGGACTCCTGGCGGG + Intergenic
950547665 3:13648221-13648243 GGTGCTCACTGCCTCCAGCCAGG - Intergenic
950745204 3:15082571-15082593 GGTGCTCAGGGACTCCTTGCTGG + Exonic
951320306 3:21236352-21236374 GGTTCTGTGTGACTGCAGGCTGG - Intergenic
952669928 3:35953996-35954018 GGTGTTCAGTGACCCTATGCAGG + Intergenic
952977453 3:38708297-38708319 GTTTCTCAGTGACCCCAGCCTGG + Intronic
954441664 3:50525541-50525563 GATGCTCAGGGACTCCCTGCTGG - Intergenic
955215268 3:56979990-56980012 CTTGCCCTGTGACTCCAGGCAGG + Intronic
962462440 3:135627008-135627030 GGTGCTGAGCTCCTCCAGGCAGG - Intergenic
964478789 3:157121502-157121524 GGACTTCAGTGACTCCAGGGAGG - Intergenic
966667399 3:182487378-182487400 GCTGCTCAGACACTCCAGGTTGG - Intergenic
968445969 4:652196-652218 GGTGCTCAGGGGCTGCAGGGGGG + Intronic
968466675 4:754984-755006 GGAGCTCAGTGTTCCCAGGCAGG + Intronic
968555234 4:1243553-1243575 GGTGCACAGTGGCCCCAGGGTGG - Intronic
968944405 4:3655770-3655792 GGTTCTGAGAGACTCCAGGGTGG + Intergenic
969034363 4:4241045-4241067 GTTGCCCAGGCACTCCAGGCTGG - Intronic
969136852 4:5036305-5036327 GGTGCTCCGTGAATACTGGCTGG + Intergenic
969271373 4:6105574-6105596 GGCGCTCAGTAACTGCATGCAGG - Exonic
969829824 4:9786287-9786309 GGAGCTCTGTGACCACAGGCTGG - Intronic
975142681 4:70934481-70934503 CTTGCTCTGTCACTCCAGGCTGG + Intronic
977492610 4:97733732-97733754 GTTGCTCAGCAACTCCATGCAGG + Intronic
984864950 4:184273333-184273355 TGAGCTCTGTGCCTCCAGGCGGG + Intergenic
985666275 5:1183023-1183045 GGTGCCCAGGGAGTCCACGCTGG + Intergenic
986052974 5:4107586-4107608 AGTGGTCAGTTATTCCAGGCTGG + Intergenic
989749941 5:44881306-44881328 TGTGCTCAGTGACGCCATGTTGG + Intergenic
989975752 5:50585007-50585029 GCTGCTCTGTAACTCCAGGTAGG - Intergenic
995560792 5:113379092-113379114 GGTCCTCAGGGACTTGAGGCAGG - Intronic
996089978 5:119340981-119341003 GAAGCTCAGTGACTCCTGGCAGG + Intronic
996230605 5:121059280-121059302 CCTGCTCCGTGACTCCATGCTGG - Intergenic
996265480 5:121534691-121534713 GGTGCTCACTAACCCCATGCAGG - Intergenic
997250445 5:132384840-132384862 GCTTCTCAGTGACAACAGGCTGG - Intronic
997452696 5:133996241-133996263 AGTCTTCAGTGACTGCAGGCAGG - Intronic
1000025886 5:157358819-157358841 TGTGGTCAGTGACTACAGGATGG - Intronic
1000333111 5:160221399-160221421 GGTGAGCAGTCATTCCAGGCAGG + Intronic
1002702825 5:181138130-181138152 GGTGGTCTGAGAGTCCAGGCTGG + Intergenic
1003030563 6:2597090-2597112 GGGGCTCAGTGACCAGAGGCAGG - Intergenic
1003175334 6:3749797-3749819 TGAGCTCCGTGACCCCAGGCAGG - Intronic
1003669927 6:8147800-8147822 GGTGCTCTGTGACTGCCTGCAGG - Intergenic
1006639125 6:35479977-35479999 GCTGCTCTGTGGCTCCAGCCTGG - Intronic
1008005102 6:46402191-46402213 AGTGCCCAGTGACTCCATGCCGG - Intronic
1010014271 6:71086393-71086415 GGTGCTCAGTAATTACCGGCTGG + Intergenic
1010744170 6:79542155-79542177 GGTACTCAGTGACTTCATGATGG - Intergenic
1012477379 6:99629443-99629465 GGTGGTGAGTGTCCCCAGGCTGG + Intergenic
1016390930 6:143574218-143574240 GCTGCTCAGTTCCTCAAGGCAGG + Intronic
1016845089 6:148561721-148561743 CTTGCTCTGTGACCCCAGGCAGG + Intergenic
1016849884 6:148607717-148607739 GCTGCTCTGTGACTCCAGGAAGG - Intergenic
1019049366 6:169171232-169171254 GAAGCTCGGTGACTTCAGGCAGG + Intergenic
1019147535 6:169984743-169984765 GCGGCTCAGTGACTCCATTCGGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019516720 7:1443321-1443343 GGTGCTCAGAGCCTCCGGGGTGG - Intronic
1019597217 7:1863717-1863739 GGTGTTCCGGGACTGCAGGCCGG - Intronic
1019651876 7:2164070-2164092 GCTTCTCAGTGAGTCCATGCTGG - Intronic
1020257366 7:6509571-6509593 GGTGTTCAGTGGCTCCCAGCTGG - Intronic
1020271518 7:6599421-6599443 GGTGCTCAGTGTCTCCTGTATGG - Intronic
1020715686 7:11673147-11673169 GGTGCTCAGTGACTCCAGGCAGG - Intronic
1022213290 7:28233054-28233076 TGTGCTCAGTGACATCAGGTTGG + Intergenic
1022950867 7:35336753-35336775 GGTGCTCAGCCACTCCTAGCTGG - Intergenic
1022961298 7:35429376-35429398 GGTGCTCAGTGACTTCATGCAGG - Intergenic
1023552782 7:41387761-41387783 GCTGCTATGGGACTCCAGGCTGG - Intergenic
1029524606 7:101087338-101087360 GCTGCTCAGGGCCTCCAGGAGGG - Exonic
1031980123 7:128119306-128119328 GGTGGTTAGTGACACCATGCAGG - Intergenic
1032388902 7:131543018-131543040 GGTGCTCTGTGACCAGAGGCTGG + Intronic
1032746984 7:134795902-134795924 GTGGGTCAGTGGCTCCAGGCTGG - Intronic
1034431395 7:151043087-151043109 GGGGTCCAGTGACTCCAGGGAGG - Intronic
1034463349 7:151210627-151210649 TGTGCTCCGTGATTACAGGCTGG - Intronic
1034465333 7:151224824-151224846 GCTGCTCAGTGACACCAAACTGG - Exonic
1035323191 7:158047459-158047481 CACGCTCAGTGACTGCAGGCAGG - Intronic
1035323194 7:158047487-158047509 CATGCTCAGTGACTGCAGGCAGG - Intronic
1035438301 7:158875771-158875793 GGTCCTCAGTGCATCCAGGAGGG + Intronic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1038491432 8:27974807-27974829 GGTCCGCTGTGACTCCAGGCAGG - Intronic
1038747431 8:30266853-30266875 GCTGCTCAGTTTGTCCAGGCTGG - Intergenic
1039233277 8:35472921-35472943 GGTGGTCAATGACACCAGGTGGG + Intronic
1039409081 8:37337022-37337044 GTTTCTCAGTGGCTGCAGGCTGG - Intergenic
1039554808 8:38468143-38468165 GGTGCTCGGCGCCTCCAGCCCGG + Intronic
1041027608 8:53703319-53703341 GGGGCTGCGTGTCTCCAGGCTGG - Intergenic
1045361001 8:101433132-101433154 GGTGCTGTGGGACTCCAAGCTGG - Intergenic
1045394197 8:101744215-101744237 GGTGCTCATCTACTGCAGGCAGG + Intronic
1047204208 8:122790404-122790426 GGTGCTCAGTGAGTGCTGACTGG - Intronic
1048114291 8:131504583-131504605 GGTGGTTAGTGTCTGCAGGCTGG - Intergenic
1048386809 8:133919695-133919717 GCTGCCAAGTGACTGCAGGCCGG + Intergenic
1048691865 8:136974769-136974791 GGTCCTCAGTGGCTGCTGGCTGG - Intergenic
1051057558 9:13005450-13005472 GGTTCCCACTGACTCCAGGATGG - Intergenic
1051525008 9:18032873-18032895 GGTGCTCAGTGACTCTGTGTGGG + Intergenic
1051675417 9:19553709-19553731 GGTGCTTAGTGACTGCTTGCAGG - Intronic
1053475907 9:38381956-38381978 CCTGTTCAGTGAATCCAGGCAGG - Intergenic
1057217710 9:93238627-93238649 GGTGCTCAGATGCTACAGGCTGG - Intronic
1057295033 9:93829866-93829888 CGTGCTGAGTGACCACAGGCAGG - Intergenic
1061451089 9:130667307-130667329 GGTCATCCGTGACTGCAGGCTGG - Intronic
1062295950 9:135826719-135826741 TGTGCTAACTGGCTCCAGGCTGG + Intronic
1062400832 9:136371916-136371938 GGTGCTCAGCGACCCCAACCTGG - Exonic
1186468546 X:9803559-9803581 GGTGCTCCGTGCCTCCTGTCAGG + Intronic
1186471117 X:9822817-9822839 AGTGCTCAGTGCCTCCGGGCAGG + Intronic
1187851229 X:23593347-23593369 CATGCCCAGTGTCTCCAGGCAGG + Intergenic
1190808684 X:53863503-53863525 GGTAGTCAGTGACTCCGTGCTGG - Intergenic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1191740979 X:64434832-64434854 CTTGCTCAGTGCCTCCTGGCCGG + Intergenic
1192451493 X:71247802-71247824 GTTGCTCGGTGACTCCGCGCTGG + Exonic
1192919333 X:75689951-75689973 TGTGCTCAGTAACCCCATGCAGG - Intergenic
1198445658 X:136711342-136711364 GGGGCACAGTGGCTCCAGCCTGG + Intronic
1199700305 X:150370858-150370880 GGAGCTCAGTGCCTACAGCCAGG - Intronic
1199983204 X:152932418-152932440 GGTGAGCAGTGGCTGCAGGCTGG + Intronic
1200122205 X:153796440-153796462 GGTGATCTGGGGCTCCAGGCAGG - Exonic