ID: 1020718280

View in Genome Browser
Species Human (GRCh38)
Location 7:11707145-11707167
Sequence CAAAGCAACCACTTTCAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020718277_1020718280 -5 Left 1020718277 7:11707127-11707149 CCTTTCTCTCCCTGAGTGCAAAG 0: 1
1: 0
2: 1
3: 29
4: 277
Right 1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG 0: 1
1: 0
2: 1
3: 19
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020718280 Original CRISPR CAAAGCAACCACTTTCAAGT AGG Intronic
900913210 1:5616849-5616871 CACAGAATCCACTTCCAAGTCGG - Intergenic
909305009 1:74062824-74062846 CACACCCACCACCTTCAAGTAGG - Intronic
909689551 1:78391647-78391669 CAAATCCACCACAATCAAGTAGG - Intronic
909995087 1:82269380-82269402 CATAACAACCAATTTTAAGTTGG + Intergenic
910122603 1:83807029-83807051 CAAAGCAAGGACTTTCAAATGGG + Intergenic
910154612 1:84200494-84200516 AAAAGCAAACACTGTCAAGTGGG - Intronic
910281000 1:85501621-85501643 TAAAGCAACCATTATCAACTTGG + Intronic
912713090 1:111963491-111963513 CACAGCAACCCTTATCAAGTAGG - Intronic
913289029 1:117255362-117255384 CAAAGCAGCCACTTCAAAGAAGG - Intergenic
916268395 1:162915563-162915585 CTCAGCATCCACCTTCAAGTAGG + Intergenic
916968426 1:169980088-169980110 CAAACTAACCACTTTGAAGGAGG + Intronic
917811487 1:178662705-178662727 CGAAGCAAGCACATTCAAGGTGG + Intergenic
918248987 1:182684910-182684932 TAAAGCAACCACTTTCACCTTGG - Intergenic
918802383 1:188987575-188987597 CAAAGCAACCACTTGAATTTTGG + Intergenic
920042566 1:203111866-203111888 AGAGGCAACCACTTTTAAGTGGG - Intronic
921525133 1:216208535-216208557 TAAAGGAACCACTTTCAAAAGGG + Intronic
922736725 1:227988093-227988115 CAAGGTAACCACTTTCAACCTGG - Intergenic
923889194 1:238192596-238192618 CAAAAGAACAACTTTAAAGTTGG - Intergenic
924361664 1:243247811-243247833 CAAATCTAACACTATCAAGTTGG + Intronic
1065063166 10:21929957-21929979 CAAAGAATACACTGTCAAGTAGG + Intronic
1065832231 10:29624934-29624956 CCAAGCAATCTCTTTCAACTTGG + Intronic
1065839040 10:29685069-29685091 CCAAGCCTCCACTCTCAAGTAGG + Intronic
1069973882 10:72197542-72197564 CAAAGCAAACCCTTGCTAGTAGG + Intronic
1071443371 10:85724057-85724079 CATAGCAATCACTTTAATGTAGG + Intronic
1072253250 10:93598556-93598578 TATAGCAATCACTTTCAAGATGG + Intronic
1074846727 10:117405291-117405313 CAAAGCAGTCACTTCCAAGAAGG + Intergenic
1075152452 10:119946454-119946476 AAAAGTGACCACTTTCAAGCTGG - Intergenic
1075439416 10:122467562-122467584 CAAAGCAACCAGGCTCAAGATGG - Intronic
1081288062 11:41296658-41296680 CAAAACAACCTCTTTCACTTTGG + Intronic
1081471036 11:43371344-43371366 CTAACCAACCAGCTTCAAGTTGG + Intronic
1082990902 11:59206414-59206436 CAAAGAACCCACTTTCAAAGGGG - Exonic
1083379182 11:62250853-62250875 CAAAGCAGTGACTTTCAACTAGG - Intergenic
1085452300 11:76641968-76641990 CAAAGCTACTACATTCAAGAAGG - Intergenic
1086188062 11:84043533-84043555 CAAACCCTCCACTCTCAAGTAGG + Intronic
1086456260 11:86961658-86961680 CAGAGAATCCACTTTCAAGATGG - Intergenic
1086892772 11:92277629-92277651 CAATGCTACCACTTACAAGTGGG - Intergenic
1086942736 11:92815246-92815268 CAAAGCCACCACTCTCATTTTGG - Intronic
1088528307 11:110780504-110780526 CAAAGCAGCCACTGTTCAGTAGG - Intergenic
1090585562 11:128208238-128208260 CAAAGCAACCACTTTTGAACTGG - Intergenic
1095484662 12:42672654-42672676 GGAAGAGACCACTTTCAAGTTGG + Intergenic
1096011644 12:48222035-48222057 CAAAGGAACCACGATCAGGTTGG - Intergenic
1100275692 12:93069884-93069906 AAAAGCAACCACTATCCAGGAGG + Intergenic
1100407674 12:94285389-94285411 CAACGCAACCACTTTCAAACTGG - Intronic
1101759908 12:107649965-107649987 CAAAGCTCCCAGTTTCAATTAGG - Intronic
1104913249 12:132250409-132250431 CAAATCAACCACACTAAAGTGGG - Intronic
1105842256 13:24265026-24265048 CAAAGCAACTGCTTTCACCTTGG - Intronic
1106292448 13:28377000-28377022 CAAAGCAACTACTGTCAAACAGG + Intronic
1107944160 13:45402333-45402355 CAAAGCAACACCATTCAAGGAGG - Exonic
1109454023 13:62559480-62559502 AACAGAAAACACTTTCAAGTTGG + Intergenic
1110783996 13:79501632-79501654 CAAAGCAAAAACTCTAAAGTTGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112829060 13:103426366-103426388 CAAACCAACTACTTAAAAGTTGG + Intergenic
1113927982 13:113951742-113951764 AAAGGCAACCACTTTGAAATGGG - Intergenic
1114052136 14:18929450-18929472 CAAAGCAAACAATATAAAGTGGG - Intergenic
1114110423 14:19472474-19472496 CAAAGCAAACAATATAAAGTGGG + Intergenic
1115132629 14:30072407-30072429 CAAAGCAATCAGTTTCAAAATGG + Intronic
1116377526 14:44222649-44222671 CAAAGTAATTAGTTTCAAGTGGG - Intergenic
1121738974 14:96238202-96238224 CAGAGGATCCACTTTCAAGGTGG + Intronic
1126899133 15:53293831-53293853 AAAAGAAAGCACTTTCAAGCTGG - Intergenic
1131889270 15:96954813-96954835 CAAAGAAACAACTTTCAAATTGG - Intergenic
1132936838 16:2485584-2485606 CTCAGCAACCAACTTCAAGTTGG - Intronic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1137966672 16:52941539-52941561 CAAGGCTGCCACTTTCTAGTGGG + Intergenic
1139813949 16:69651530-69651552 AAAAGCAACCAGATTCCAGTAGG - Intronic
1140633785 16:76887105-76887127 CAAAGCAAACACTCTCAATGTGG + Intergenic
1141216851 16:82033151-82033173 AAAAGCCACCTCTCTCAAGTGGG + Intergenic
1141938172 16:87255723-87255745 CAAAGCCACCACTCCCAAGCTGG + Intronic
1143216050 17:5225809-5225831 GAGAGCAACCAGCTTCAAGTTGG - Intronic
1143872770 17:9969544-9969566 CACAGCAACCACTTTCTACCTGG + Intronic
1144310729 17:14011859-14011881 AAATGCAACCACTTTCAGGTTGG + Intergenic
1147814624 17:43200135-43200157 GAAAGCAACCAATTTTAAGGTGG - Intronic
1147868955 17:43573871-43573893 CAATGCAACCCCTTTTAAGTTGG + Intronic
1150731021 17:67693987-67694009 TCAAGCAACTACTGTCAAGTGGG + Intronic
1155719110 18:28988574-28988596 CTAAGCAACCACTTGCTATTTGG - Intergenic
1158614916 18:58978162-58978184 GACAGCAAACACTGTCAAGTAGG - Intronic
1159403806 18:67973983-67974005 CAAATCCACCACTATGAAGTAGG - Intergenic
1160478132 18:79211451-79211473 CATAGCAGCCTCTTTGAAGTAGG + Intronic
1160945326 19:1640056-1640078 CAAAGAAACCACCTAAAAGTTGG + Intronic
1163328795 19:16622770-16622792 CAAAGCACCCAGTTTCCAGAAGG + Intronic
1167274063 19:48524627-48524649 ATAAGAAACCACTTTCAAGATGG - Intergenic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
927143987 2:20148986-20149008 CCAAGCCAGCACTTTAAAGTCGG - Intergenic
929255478 2:39806699-39806721 CTAATCCACCACATTCAAGTAGG - Intergenic
929431581 2:41892194-41892216 CAAGGCAGCCAATTTCAATTTGG - Intergenic
930918899 2:56726852-56726874 CCCAGCCACCACTCTCAAGTAGG + Intergenic
932991110 2:76789147-76789169 CAAAGGGAGCACTCTCAAGTGGG + Intronic
933147903 2:78878409-78878431 CACAGCATACACTATCAAGTTGG + Intergenic
934546526 2:95221826-95221848 CATAGCAAACACCTTTAAGTGGG - Intronic
935466789 2:103407968-103407990 AAAAGAAATAACTTTCAAGTAGG - Intergenic
936583608 2:113730009-113730031 CAAAGCATCCTCTTTCTAATCGG + Intronic
936631936 2:114212956-114212978 CAAAGCTAACATTTCCAAGTTGG - Intergenic
937577305 2:123439061-123439083 CATAGCATCCGCTTTCAAATTGG + Intergenic
939006858 2:136798662-136798684 CAAAGCAACCACCTCCAAACTGG + Intronic
941080667 2:161057221-161057243 CAGAGCAACCACTTTAAACAGGG + Intergenic
941630948 2:167883559-167883581 CACAGGAACTAATTTCAAGTGGG - Intergenic
942744443 2:179215782-179215804 CTAATCCACCACTATCAAGTTGG + Intronic
945322471 2:208441112-208441134 CTGAGTAACCACCTTCAAGTTGG + Intronic
945600976 2:211864336-211864358 GAAAGCAGTCACTTTCATGTGGG - Intronic
946001693 2:216487678-216487700 CAGAGCAACCACTCACAAGGGGG - Intergenic
1169170017 20:3457437-3457459 CAAAGCAACCACCTTGGAGCTGG - Intergenic
1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG + Intronic
1170850766 20:20002649-20002671 CAATGAAAACACTTTCAGGTGGG - Intergenic
1171402368 20:24883111-24883133 AAAAGCAACCACTTTTAAGTGGG + Intergenic
1172677383 20:36683281-36683303 CCCACCAACTACTTTCAAGTTGG + Intronic
1175513206 20:59548971-59548993 CTAATCCACCACTATCAAGTAGG + Intergenic
1176421619 21:6520565-6520587 CAAAGCAACCCCAGTCTAGTAGG - Intergenic
1177426232 21:20925861-20925883 CTAATCCACCACGTTCAAGTTGG + Intergenic
1178029347 21:28506233-28506255 CAAAGAAATGACTTTCAAGTTGG - Intergenic
1178505858 21:33162559-33162581 TAAAGCAAGCACTGTCAATTTGG + Intergenic
1179697109 21:43128881-43128903 CAAAGCAACCCCAGTCTAGTAGG - Intergenic
1180470608 22:15651823-15651845 CAAAGCAAACAATATAAAGTGGG - Intergenic
1180616031 22:17128048-17128070 CAAGGCATCAACTTTCAAATTGG + Intronic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1184167257 22:42737169-42737191 CAAAGCAACCACTTCAAATTTGG - Intergenic
1184397049 22:44248516-44248538 AAATCCATCCACTTTCAAGTAGG - Exonic
949301523 3:2589723-2589745 TAGAGCACCCACTTTCAAGTTGG + Intronic
950599762 3:14023008-14023030 CAAATCCACCATTATCAAGTAGG - Intronic
951727700 3:25778512-25778534 CAAAGCAGCCATTATCATGTTGG - Intronic
952642748 3:35617212-35617234 GAAAGCAATCACTTTCATGTGGG + Intergenic
953272569 3:41459766-41459788 CACAGCATCCACTTACAAGATGG + Intronic
955325430 3:58006486-58006508 CAAAGCAATTTCTTTCAAGTCGG - Intergenic
955618633 3:60836759-60836781 CAAAGCAATCACTTTGATTTTGG + Intronic
956673184 3:71710331-71710353 CACAGCAACAGATTTCAAGTTGG + Intronic
957624327 3:82640285-82640307 CAAAGCAATTACCTTCAAGTAGG - Intergenic
958013501 3:87911708-87911730 CTAATCCACCACTCTCAAGTAGG + Intergenic
958942433 3:100331176-100331198 CTGACCAACCACTTTCAAGTTGG - Intergenic
959957585 3:112256369-112256391 CTAAGCCACCACAATCAAGTAGG + Intronic
960688439 3:120317553-120317575 CTAATCCACCACTATCAAGTAGG + Intergenic
963782630 3:149502179-149502201 GAAAGCCACCACTAACAAGTAGG - Intronic
966086318 3:176071193-176071215 AGAAGCAACCACTGTTAAGTTGG + Intergenic
967642646 3:191884712-191884734 CAAACCTACCAATTACAAGTTGG - Intergenic
970516954 4:16841809-16841831 CCAACCTACCATTTTCAAGTAGG + Intronic
970848716 4:20575555-20575577 CAAAGCATGCACTTTGAGGTGGG + Intronic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
973877334 4:55232973-55232995 AAAAGCCACCACGATCAAGTTGG - Intergenic
974720909 4:65736991-65737013 TAAAGCCACCAATTTTAAGTGGG - Intergenic
975816644 4:78223889-78223911 CAAATCAACCTCTTTCATTTTGG - Intronic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
978461886 4:108964740-108964762 CAATGCAACAACTTTTTAGTGGG + Intronic
979013512 4:115401087-115401109 CAAAGCAACCACTTCAATTTTGG + Intergenic
980197955 4:129615789-129615811 CCAAGCATCCACTTAAAAGTTGG - Intergenic
980537037 4:134139282-134139304 CCAAGCAGCCACTTTCTGGTAGG + Intergenic
982091934 4:151887705-151887727 CATAGCAACCACAGGCAAGTCGG + Intergenic
983770469 4:171542376-171542398 CAAAGCAGGCACTTTGAAGAAGG - Intergenic
985073208 4:186189334-186189356 TAAAGAAAGCTCTTTCAAGTGGG + Intergenic
987210477 5:15677035-15677057 CAAACAAACCTCTTTCATGTTGG + Intronic
989190193 5:38663434-38663456 CAAAGCATCTATTTTGAAGTGGG - Intergenic
991207155 5:64062262-64062284 CAAAGGAAGCACTTGCAACTTGG + Intergenic
991586145 5:68203791-68203813 GAAAGCAACAACTTTCTATTTGG - Intergenic
993938855 5:94034651-94034673 CAAAAGAAGCACTTTCTAGTTGG + Intronic
995380399 5:111525293-111525315 CGAGGCAAACACTTTCAGGTAGG + Intergenic
996599335 5:125243737-125243759 CTAAGCCACCATTTTCAAGCAGG - Intergenic
998375657 5:141688940-141688962 CCAAGCAACTACTTTCCAGATGG - Intergenic
999706320 5:154275636-154275658 CACAGCATCCACTTCCAAGATGG + Intronic
999783831 5:154873236-154873258 AAAAACAACCACTTTCAAAGTGG - Intronic
1003976300 6:11347588-11347610 CTAATCAACCACAATCAAGTAGG + Intronic
1004269221 6:14179131-14179153 CAAAGCAACCACTCTGGAGTAGG - Intergenic
1007212797 6:40210339-40210361 TAAAACAACCACTTTCCATTAGG - Intergenic
1007839624 6:44705012-44705034 GAAAGAAACCATTGTCAAGTTGG - Intergenic
1011184038 6:84654498-84654520 CAAAGGAACCATTTTCTAGAAGG + Intergenic
1012668766 6:102013779-102013801 CAAATCCACCACAATCAAGTAGG - Intronic
1012810200 6:103947547-103947569 CTAACCAACCACAATCAAGTAGG - Intergenic
1014649985 6:124024431-124024453 CAAAACAAGCCCTTTCACGTTGG + Intronic
1014858920 6:126439379-126439401 ATAACCAACCTCTTTCAAGTGGG - Intergenic
1015752794 6:136577480-136577502 CAAAGAAACCAATTTCATGGTGG + Intronic
1015844526 6:137506101-137506123 CACATCAAACATTTTCAAGTGGG + Intergenic
1016580730 6:145627278-145627300 CAAGCCAACCACTTTCACCTGGG - Exonic
1019728799 7:2618493-2618515 AAAAGCTCACACTTTCAAGTTGG - Intergenic
1020150777 7:5680259-5680281 CAAAGGAACCACTTCCCTGTTGG - Intronic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1023458784 7:40370445-40370467 CAAAGCAACCAACTTCATATGGG - Intronic
1024136164 7:46411546-46411568 CTAACCAACTACTGTCAAGTTGG + Intergenic
1026088350 7:67280614-67280636 CAAAGCAACCTCTTCCACCTGGG - Intergenic
1026725903 7:72869713-72869735 CAAAGCAACCTCTTCCACCTGGG + Intergenic
1027117955 7:75495952-75495974 CAAAGCAACCTCTTCCACCTGGG - Intergenic
1027327300 7:77058580-77058602 CAAAGCAACCTCTTCCACCTGGG + Intergenic
1029719551 7:102354103-102354125 CAAAGCAACCTCTTCCACCTGGG + Intergenic
1029753064 7:102555155-102555177 CAAAGCAACCTCTTCCACCTGGG - Intronic
1029771015 7:102654247-102654269 CAAAGCAACCTCTTCCACCTGGG - Intronic
1030427567 7:109398509-109398531 CAAAGCAACCACTGGAATGTGGG - Intergenic
1030436360 7:109526552-109526574 CAAAGCAACTACTTAGAAGAAGG + Intergenic
1032640674 7:133763721-133763743 AACAGCAAACACTTTCAAGAGGG + Intronic
1035345299 7:158193352-158193374 GAAAGCAGCCACTTGCCAGTGGG + Intronic
1039807487 8:41013275-41013297 CCACCCAACCACCTTCAAGTAGG + Intergenic
1040622420 8:49104951-49104973 CAAAGCAAGCATTTTTATGTAGG + Intergenic
1041910602 8:63085438-63085460 CAAAGTAACAGCTTACAAGTTGG - Intronic
1042003724 8:64156818-64156840 CAAACCAAATACTTTGAAGTAGG + Intergenic
1042041655 8:64598139-64598161 CATTGCATCCACTTGCAAGTTGG - Intronic
1042218447 8:66450284-66450306 CAAAGCAGCCACCCTTAAGTGGG + Intronic
1042524121 8:69746899-69746921 CAAACCAACCAATCCCAAGTTGG + Intronic
1046729898 8:117713565-117713587 CATAACAACCCCTTTCAACTGGG + Intergenic
1048180110 8:132186710-132186732 CAATGGAACCTCTTTCAATTGGG + Intronic
1048759436 8:137776811-137776833 TAAAGGATCCACTTTCAAGATGG - Intergenic
1049136369 8:140904346-140904368 CATATCCACCACTATCAAGTCGG - Intronic
1055613835 9:78050994-78051016 CCAAGCAAACCCATTCAAGTTGG - Intergenic
1057682303 9:97200105-97200127 CAACGCAAACCCTTTCAAGCTGG + Intergenic
1058006694 9:99923731-99923753 CTAAACAACCAGCTTCAAGTTGG + Intronic
1186229524 X:7438469-7438491 CAAATCAACCTTTTTCATGTCGG - Intergenic
1186487178 X:9942481-9942503 CTGACCAACCACCTTCAAGTTGG + Intronic
1186783162 X:12933666-12933688 CTAATCAACCACAATCAAGTAGG + Intergenic
1186869184 X:13753081-13753103 GAAAGCAATCACTTTTCAGTTGG - Intronic
1187900492 X:24023330-24023352 AAAACCAGCCACTTTGAAGTAGG + Intronic
1188239942 X:27773657-27773679 CAAACAAACCACTTTGCAGTAGG + Intergenic
1189735252 X:44063603-44063625 AAATGCAATCACTATCAAGTTGG - Intergenic
1189738802 X:44097903-44097925 CAAGGAAGCCACTATCAAGTTGG + Intergenic
1190972259 X:55361700-55361722 AAAAGCAAAAATTTTCAAGTGGG + Intergenic
1191721135 X:64229989-64230011 GAAACCAACCACTTTCCTGTGGG - Intronic
1192311364 X:70017492-70017514 CTAAGCCACCACAATCAAGTAGG + Intronic
1193927871 X:87512096-87512118 CTAATCAACCACAATCAAGTAGG - Intergenic
1194344686 X:92749249-92749271 TAAAGCAACCACAAACAAGTAGG - Intergenic
1194504166 X:94712199-94712221 CTAATCAGCCACATTCAAGTAGG + Intergenic
1196065681 X:111461689-111461711 CATAGCAACCACGTTCAGGAAGG - Intergenic
1197395859 X:125926243-125926265 CAAAGCTTCTTCTTTCAAGTTGG + Intergenic
1197557841 X:127978140-127978162 CTGACCAACCACCTTCAAGTTGG + Intergenic
1199275920 X:145941685-145941707 CTAATCAACCATGTTCAAGTAGG - Intergenic
1199942664 X:152640313-152640335 CAAGGCAACCACTGGCAAGCGGG + Intronic
1200575218 Y:4881360-4881382 CAAAGGAACCTCTTTCAAAAGGG - Intergenic
1200653032 Y:5865890-5865912 TAAAGCAACCACAAACAAGTAGG - Intergenic
1202021777 Y:20472910-20472932 CTAAGGAAACACTTTCAAATGGG + Intergenic