ID: 1020723293

View in Genome Browser
Species Human (GRCh38)
Location 7:11776705-11776727
Sequence CTGGATAAACTGATAAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020723293 Original CRISPR CTGGATAAACTGATAAAACA TGG Intronic
901639185 1:10684789-10684811 CTGGGTGAACTGATGACACAGGG + Intronic
904334696 1:29789423-29789445 CTGGAAAAACTGGAAAGACATGG - Intergenic
905574686 1:39034422-39034444 CGGGATAAGCTGATAAAGGAAGG + Exonic
905622917 1:39464368-39464390 TTGGATATACTAATGAAACATGG - Intronic
906484180 1:46221810-46221832 CTGGAGAAACTGAAAAGGCATGG - Intergenic
907198915 1:52709368-52709390 CGGGATAAGCTGATAAAGGAAGG + Intergenic
908095088 1:60729301-60729323 CAGGATAAAATGAAAAAACATGG + Intergenic
910557313 1:88549927-88549949 CTGAATAAAAGGATAAAAGAAGG + Intergenic
910933739 1:92468643-92468665 CTGCAAAAACTAATAAAATAGGG + Intergenic
912336283 1:108866075-108866097 CTGGATGAAGGGATAAAGCATGG + Intronic
913687003 1:121241654-121241676 AAGGAGAAACTCATAAAACATGG - Intronic
914038862 1:144029293-144029315 AAGGAGAAACTCATAAAACATGG - Intergenic
914150591 1:145038635-145038657 AAGGAGAAACTCATAAAACATGG + Intronic
915310726 1:155004693-155004715 CTGGAGCAGCTGATGAAACAAGG + Intronic
916081143 1:161233175-161233197 CTGCACAAACTGTTCAAACATGG + Exonic
916723819 1:167505322-167505344 CTAGATATACTAATAATACATGG + Intronic
916884124 1:169050632-169050654 ATGGATAAAATGAGAAACCATGG + Intergenic
917841111 1:178978997-178979019 ATAGATACACTGAAAAAACAAGG + Intergenic
919145185 1:193625278-193625300 CTGGACAAACTGAAAAACGAGGG + Intergenic
920474332 1:206260173-206260195 AAGGAGAAACTCATAAAACATGG - Intronic
921995795 1:221416681-221416703 CTGTATAAACTTAAAAAATATGG - Intergenic
1063577827 10:7277962-7277984 CTGAATAAACTGCGGAAACAGGG - Intronic
1065298070 10:24295624-24295646 GTGGATAAAATGGTGAAACAGGG - Intronic
1065890251 10:30115209-30115231 GGGAATAAAGTGATAAAACAAGG - Intronic
1069575729 10:69527178-69527200 CTGGATGAACCTTTAAAACAGGG + Intergenic
1070745603 10:78931879-78931901 CTGAATAAATTGGTTAAACAAGG - Intergenic
1070851695 10:79568862-79568884 CTGGCTAAATGGATAAAAAAAGG - Intergenic
1072025500 10:91451598-91451620 CTGGAAAACTTGTTAAAACATGG - Intronic
1073971538 10:109049363-109049385 GTAGATAAGCTGAAAAAACAAGG - Intergenic
1075330359 10:121569771-121569793 CTTGGTAAACTGAGAAAGCAAGG + Intronic
1076485384 10:130812344-130812366 CTGGATAAATGGATAAGGCAGGG - Intergenic
1077814969 11:5678009-5678031 CTGGATAAATTAATAAAAATGGG + Intronic
1078636580 11:13056051-13056073 CTGAATAAACTGATATACCAGGG - Intergenic
1081535865 11:43995832-43995854 CTGGTTCAACTCATAATACATGG - Intergenic
1083229879 11:61310078-61310100 ATGGATAATCTGATGAGACAGGG - Intronic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1087590556 11:100182934-100182956 ATGAATAAATTGATAAAAAAGGG + Intronic
1088637035 11:111831770-111831792 CTGGTTAAACTGGAAAAGCAGGG + Intronic
1088940996 11:114455889-114455911 ATGGCTAAACTGCTAAAAAATGG - Intergenic
1089477497 11:118776961-118776983 CTGGATAAAGTATCAAAACAAGG - Intronic
1089713179 11:120332026-120332048 ATGAACAAACTAATAAAACAAGG + Intronic
1090223307 11:125050335-125050357 ATGGATGAACTTATTAAACATGG + Intergenic
1090263139 11:125336332-125336354 ATAGATAAACTGAGAAAAAAGGG - Intronic
1091868432 12:3863909-3863931 CTGGACAAACTGGTATAGCACGG + Intronic
1092806100 12:12224672-12224694 ATATATAAACTGATATAACATGG + Intronic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1093416842 12:18929830-18929852 CTGGATACCCTGATAGGACAGGG + Intergenic
1095535470 12:43240917-43240939 TTAAATAAACTGATAAAATAAGG + Intergenic
1098668045 12:73189304-73189326 TTGGATAAACTGAAAAATAATGG + Intergenic
1098944780 12:76577520-76577542 CTAGATAAACTGGAAAAAAATGG + Intergenic
1099369071 12:81807936-81807958 CTGAATAAATGGATAAAATATGG + Intergenic
1101482275 12:105109390-105109412 AGGGATAAAAAGATAAAACAAGG + Intronic
1101504672 12:105335184-105335206 TGGGATACACTGATAAAATAGGG - Intronic
1101546164 12:105715092-105715114 TTTGAAGAACTGATAAAACAAGG - Intergenic
1101698293 12:107147640-107147662 GTGAATAAACAGGTAAAACAAGG - Intergenic
1105568922 13:21580915-21580937 CAGGATAAGCTAGTAAAACAGGG + Intronic
1108463506 13:50691835-50691857 CTTTATAAACTGATATATCATGG + Intronic
1108628983 13:52262224-52262246 CTGGATACTCTGATTAAAAATGG + Intergenic
1108991975 13:56670910-56670932 CTGGTCAAACTGGTACAACATGG + Intergenic
1109184914 13:59256874-59256896 ACGGATAAACTGAGAAAGCAGGG + Intergenic
1109398122 13:61787661-61787683 CATGAAAAACTGATAAATCAAGG + Intergenic
1109663743 13:65501545-65501567 CTCCATAAACTGATAAAAGTGGG + Intergenic
1109878531 13:68438537-68438559 CTGGATAAAATGATAAAAAGTGG - Intergenic
1110319404 13:74143277-74143299 CTGGATAAAATGTAAAAACCAGG - Intergenic
1110680900 13:78310613-78310635 CTGAATAAAATCAGAAAACAGGG + Intergenic
1111243969 13:85510231-85510253 CTGGATAAACTGAAAATCGATGG - Intergenic
1111245606 13:85535351-85535373 TTGGATAAACTGAAAATCCAGGG - Intergenic
1113010190 13:105755870-105755892 CTTGATATACTGGTCAAACAAGG + Intergenic
1114233757 14:20806295-20806317 CAGGAAAAACTCAAAAAACAGGG - Intergenic
1114325947 14:21588802-21588824 CTCCTTAAACTCATAAAACAAGG + Intergenic
1114329325 14:21620182-21620204 CCTGATAAACTGATAAAATATGG - Intergenic
1117667914 14:58076725-58076747 CTGGGTAAACTGAGAAAGAAGGG + Intronic
1118140101 14:63071686-63071708 TTGGATAATATGACAAAACAAGG - Intronic
1118407296 14:65438474-65438496 CTGGAAAAAATGATAAAGAATGG - Intronic
1118593354 14:67418045-67418067 CTGGATAAAATGTTAAAGCTGGG + Intergenic
1122391049 14:101384829-101384851 CTGGAAAAACTCATAACTCATGG - Intergenic
1122579891 14:102764876-102764898 CTTGTTAAACTGATGAAGCAGGG + Intergenic
1124575125 15:30901438-30901460 ATGGATGAACAGATAAAGCATGG - Intergenic
1125772934 15:42183770-42183792 TTGGATAAAGAGACAAAACAAGG - Intronic
1127201102 15:56651978-56652000 CTGGATAAACTTTTAAAAACTGG + Intronic
1129091524 15:73156581-73156603 TTGCAACAACTGATAAAACAAGG - Intronic
1130039761 15:80396307-80396329 CTGGTTACTCTGATACAACAGGG - Intronic
1131557164 15:93409829-93409851 CTGGAAAAACTGAAAAGAAAAGG + Intergenic
1131886436 15:96919516-96919538 ATGGATAAATGGATAAACCATGG - Intergenic
1131977850 15:97963372-97963394 ATGGAAAAACTGATAAAAATGGG - Intronic
1133957151 16:10454023-10454045 CTTGCAAAACTGATAAAAGATGG - Intronic
1134295304 16:12940249-12940271 CTGGATAAGCTGTTAGAAGAGGG - Intronic
1135286907 16:21201337-21201359 CTGGGTAACCTGATAGTACAGGG + Intronic
1137627587 16:49919445-49919467 CTGGACAAACCGTTAAATCAAGG - Intergenic
1138781549 16:59794595-59794617 TTGGAGAAACTGATAAAGCTGGG + Intergenic
1139060783 16:63248988-63249010 TTGTATAAACAGAAAAAACAAGG + Intergenic
1140781485 16:78300897-78300919 ATAGATGAACTGACAAAACATGG - Intronic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1144417596 17:15066324-15066346 CTGGATGAAATGATAACAAAAGG + Intergenic
1145850554 17:28091120-28091142 ATGGATAAATTGTAAAAACAAGG + Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1146613529 17:34331920-34331942 CTGGATAAACTGCTGAAGGATGG - Intergenic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1148470025 17:47887311-47887333 CTGCATAACCTTATATAACAAGG + Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1149899977 17:60466364-60466386 ATGGATAAACTATCAAAACATGG - Exonic
1150899056 17:69249985-69250007 CTGGAAAAAAAGATAAAATATGG + Intronic
1151235593 17:72717602-72717624 CTGGGTACCCTTATAAAACAAGG - Intronic
1153298117 18:3567549-3567571 CTGAAGAACCTGACAAAACAGGG - Exonic
1153323429 18:3794824-3794846 CTGGCTAATCTGATAACATATGG + Intronic
1157061651 18:44298997-44299019 ATGGATAAACTGGGAAAATATGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159114354 18:64095894-64095916 CTGGAAAAATTTATGAAACATGG + Intergenic
1159863660 18:73679713-73679735 CTAGATGAACTGAAAAGACACGG + Intergenic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162816960 19:13201614-13201636 ATGATTAAAGTGATAAAACAGGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1167352289 19:48982859-48982881 CTGAATGAACAAATAAAACATGG - Intronic
1167372291 19:49090378-49090400 CTGGAGACAGTGGTAAAACAGGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
927456950 2:23261200-23261222 CTTGATAAAGTGTTAAATCAGGG - Intergenic
931157862 2:59655714-59655736 CTTGATAACCTTATAAAACATGG + Intergenic
931638243 2:64359836-64359858 CTGGAGAAAGGGATGAAACAGGG - Intergenic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
934135141 2:88988485-88988507 CTGGATAAATTGTCAAGACAGGG - Intergenic
936242109 2:110796724-110796746 CTGGCTACCCTGATAAGACAAGG + Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
939377778 2:141392086-141392108 CTGGTTAAGCTGATGAAGCAAGG + Intronic
939941872 2:148361443-148361465 TTGGAAATACTAATAAAACAGGG - Intronic
941542704 2:166806329-166806351 CTGGATATAGTGCTAAACCAAGG - Intergenic
943978212 2:194510475-194510497 TAGGATAGCCTGATAAAACATGG - Intergenic
944320516 2:198335969-198335991 CAATATAAACTTATAAAACAGGG + Intronic
944548861 2:200826721-200826743 CTGGATAAGATGACAAAGCAAGG - Intergenic
945151156 2:206793283-206793305 CTGGATAAATTGATACAACCTGG - Intergenic
947003518 2:225485622-225485644 CTGGATAAATGAATACAACAGGG - Intronic
1169038548 20:2473483-2473505 TTTGATGAACTGATAAAATATGG - Intronic
1169862653 20:10169176-10169198 TTGGATAAATTGATAATAAAAGG + Intergenic
1170108364 20:12777695-12777717 ATTGATAAAATGATAAAAGATGG + Intergenic
1170514422 20:17113833-17113855 TTGGGTAAAATGATAAACCAAGG - Intergenic
1174811579 20:53650044-53650066 CTGGCTAACATGATGAAACACGG - Intergenic
1176691351 21:9914332-9914354 CTGGTTAAATTGATACCACATGG - Intergenic
1179383133 21:40918154-40918176 CTGGACAAAGTGATGAAAGAAGG + Intergenic
1180556631 22:16583553-16583575 CTGGCTAACATGATGAAACACGG + Intergenic
1181869931 22:25890123-25890145 CTACATAAACTTATAAAATATGG - Intronic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
952601365 3:35087633-35087655 CCGGATTAACTGCTAAAACATGG + Intergenic
955715769 3:61828136-61828158 CTTGATAGACTGAGAAAAAAAGG - Intronic
956931191 3:74045191-74045213 CTGGATAAATTGAAAACAGATGG - Intergenic
959002349 3:100979113-100979135 CTGGATAAACTCAGAACACTGGG - Intronic
959858946 3:111194947-111194969 CTAGATAATTTGATAAAGCATGG - Intronic
959927762 3:111943305-111943327 CTGGATCAACTGAGTCAACATGG + Intronic
963144966 3:141984076-141984098 ATGGATAAACAGATAAAATGTGG + Intronic
964332384 3:155618470-155618492 CTGGATAGACTGTTAAAGAATGG + Intronic
969940792 4:10728961-10728983 CTGTATAAAGTGATCAAACTTGG - Intergenic
970563422 4:17306168-17306190 CAGGATAAACAGCTAACACATGG + Intergenic
971183016 4:24348873-24348895 CTTGGTAATATGATAAAACAAGG - Intergenic
971286583 4:25295777-25295799 CTAGATTAAAAGATAAAACAAGG - Intergenic
971386484 4:26145099-26145121 CTGGAAAAACTGTTGAAACCAGG - Intergenic
971773842 4:30933987-30934009 GGGGAAAAACTGATAAAATATGG - Intronic
973030920 4:45337730-45337752 CTGGATGAAATGAGAGAACATGG - Intergenic
974167629 4:58224302-58224324 CTTGATAGACTGAGGAAACATGG + Intergenic
974195021 4:58562979-58563001 CTGGTTAAACTTGTAACACAAGG - Intergenic
977229081 4:94430508-94430530 CTAGAAAGACTGATAAAGCATGG - Intergenic
978120136 4:105069010-105069032 CTCAATAAACTGATTAAATATGG - Intergenic
978749158 4:112227752-112227774 ATGGATAAACTCATATCACAGGG + Intergenic
979651859 4:123143160-123143182 CTGGAAAAACTAATAATACAGGG - Intronic
979813516 4:125069078-125069100 CTTGATAAAATGCTACAACATGG + Intergenic
980363937 4:131774519-131774541 CTGGTTAAATTGATACCACATGG - Intergenic
981294597 4:143117040-143117062 CTGGAGAAACTGTAAAAGCAAGG + Intergenic
981944356 4:150323915-150323937 CTGGGAAAACTGATGAAACCTGG - Intronic
982507936 4:156243158-156243180 CTGGATAAGATGATAAAAAGGGG - Intergenic
982650254 4:158079733-158079755 CTGGAAAAACTCATAATTCAAGG - Intergenic
982762168 4:159298171-159298193 CTTAATAAACTGATAAGATAAGG - Intronic
982862243 4:160467221-160467243 CTGGATAAACTGATATCTGAGGG - Intergenic
982930342 4:161396879-161396901 ATTGATAAACTAATAAAAGAAGG + Intronic
983346140 4:166527171-166527193 CTGGAAAAACTGAGAAAAACTGG + Intergenic
985443980 4:190009492-190009514 ATAGATAAACTCATAACACAGGG - Intergenic
986383800 5:7211231-7211253 TTGGATAAAGTGATAGAAAATGG - Intergenic
986869851 5:12032938-12032960 GTGGATAAAGTGATAAAAGAAGG + Intergenic
987009899 5:13751829-13751851 CTGGGCAAGCTGATAAAACCTGG - Intronic
988268773 5:28986889-28986911 CTGGAAAAAATGATGAAAGAAGG - Intergenic
988595550 5:32586783-32586805 CAGGAAAAACGGATAAAACGTGG + Intronic
989128987 5:38085384-38085406 TTGGAAAAACTAAGAAAACATGG - Intergenic
989446710 5:41538033-41538055 TTGTATAAAGTCATAAAACATGG + Intergenic
989796243 5:45477178-45477200 CTTGATAAAGTGATGAAACATGG - Intronic
990146624 5:52768258-52768280 CTGCATAAACTGGTAAGATATGG + Intergenic
991132837 5:63144862-63144884 CTGGAGAAACTTAAAAATCAAGG - Intergenic
991215891 5:64157118-64157140 CTGGGGAAACTCATAGAACAAGG + Intergenic
992488384 5:77217279-77217301 TGGAATAAACTGATAAGACAGGG - Intronic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
994334141 5:98544583-98544605 ATGCATAAACTGATGAAATAAGG + Intergenic
994640366 5:102401020-102401042 ATGGAGAAAATAATAAAACAAGG + Intronic
995344470 5:111096049-111096071 AATGATAAACTTATAAAACAGGG + Intronic
995602495 5:113813025-113813047 CTGGAAAACCTCATAAATCATGG + Intergenic
996237194 5:121145522-121145544 TTGGATAAAGTGATTAAAAATGG - Intergenic
998598721 5:143562279-143562301 ATAAATGAACTGATAAAACATGG + Intergenic
998717685 5:144904663-144904685 CTGGAAAAACTGCTTGAACATGG + Intergenic
1000718027 5:164671044-164671066 ATGGAGAAACTGATCAAAGAGGG - Intergenic
1001330380 5:170758182-170758204 TTGCAGAAACTGAGAAAACATGG + Intergenic
1002798604 6:498717-498739 CAAGGTAAACTGAAAAAACATGG - Intronic
1002918313 6:1546851-1546873 CTGAATTAACAGATAAAACGAGG - Intergenic
1003008711 6:2406118-2406140 CTGGAGAAAATAAGAAAACAAGG - Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004129967 6:12910203-12910225 CTGTATAAGCTGATAGACCAAGG + Intronic
1004945938 6:20613216-20613238 TGTGATGAACTGATAAAACAAGG - Intronic
1006015600 6:31078391-31078413 CTGGAGAAACTGACCAGACAAGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006883114 6:37356452-37356474 GTGGATAAAATAATAAAACAGGG + Intronic
1007126299 6:39428555-39428577 ATGAATAAACGAATAAAACAAGG - Intronic
1007323927 6:41046080-41046102 CTGGAACAACTGAAAAAAGAAGG + Intronic
1008061441 6:47001355-47001377 CTGGATGAACTCTGAAAACATGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008790332 6:55224314-55224336 ATGGATAAACGTAGAAAACATGG + Intronic
1009961418 6:70527103-70527125 CTAGATAAACTCATAAAACTTGG - Intronic
1010806488 6:80243115-80243137 CTGGACAATAGGATAAAACAAGG + Intronic
1013328463 6:109071930-109071952 TTTGAAAATCTGATAAAACACGG + Intronic
1013386479 6:109636783-109636805 ATGGATGAACTGATAAAATGTGG - Intronic
1014595050 6:123325610-123325632 CTGTTTAAACTGATATAACAGGG - Intronic
1015910450 6:138163492-138163514 CTGGGTAACATGATAAAGCAGGG + Intronic
1016280461 6:142412035-142412057 CTGGCTAATAAGATAAAACAGGG - Intronic
1016778437 6:147932113-147932135 CTATATATAATGATAAAACAAGG - Intergenic
1016930452 6:149402191-149402213 CTAGATAAATTGAGAAAAAAAGG + Intronic
1020723293 7:11776705-11776727 CTGGATAAACTGATAAAACATGG + Intronic
1021812716 7:24418974-24418996 CTGGCTAAGCTGATATAACAAGG + Intergenic
1023335891 7:39169749-39169771 TTGGATAAATTAATAAAATAAGG + Intronic
1023383593 7:39632937-39632959 TTGTATAAACTGAGAAACCATGG - Intronic
1026302979 7:69115093-69115115 CTGGAAAAACTTATAATTCATGG - Intergenic
1026474363 7:70721548-70721570 CTGGATAAATTGACAAAAGAAGG - Intronic
1030211037 7:106995972-106995994 CTGGATAATTGCATAAAACAGGG + Intergenic
1030994684 7:116345079-116345101 CTAGATAAACTAAGAAAAAAGGG - Intronic
1031798264 7:126206686-126206708 CTTTATAAATTGATAATACAAGG - Intergenic
1038163386 8:25061674-25061696 CTGGCTAAACTCATACAGCAGGG + Intergenic
1038609060 8:29042616-29042638 CTGGACAAAGTCATAAAATAGGG - Intronic
1038809352 8:30824172-30824194 ATGGACAAATTAATAAAACATGG - Intergenic
1040091921 8:43407906-43407928 CTGGAAAAACTGAGGCAACAAGG - Intergenic
1042432536 8:68725607-68725629 CAGGATAAAGTGATAAGCCACGG - Intronic
1043125269 8:76386188-76386210 TTGGATAAACTTATAAACCGTGG + Intergenic
1043350708 8:79357700-79357722 CTAGATAAGGTGATAAAATATGG + Intergenic
1043888894 8:85634251-85634273 CTGTCTTAACAGATAAAACAAGG + Intergenic
1046335194 8:112776971-112776993 CTGGATAGAATGATTAAGCATGG + Intronic
1047105341 8:121725135-121725157 CAGGCTAAAATAATAAAACAAGG + Intergenic
1049066311 8:140319097-140319119 TTGGATAATCTGATCAAAAATGG - Intronic
1049930055 9:447644-447666 ATGGAGAAACTGATGAACCATGG - Intronic
1053628283 9:39900402-39900424 CTGGTTAAATTGATACCACATGG - Intergenic
1053777776 9:41565924-41565946 CTGGTTAAATTGATACTACATGG + Intergenic
1054215604 9:62350299-62350321 CTGGTTAAATTGATACCACATGG + Intergenic
1054364277 9:64316499-64316521 CTGGTTAAATTGATACCACATGG - Intergenic
1054671877 9:67805052-67805074 CTGGTTAAATTGATACCACATGG - Intergenic
1055490101 9:76795972-76795994 CTGCAGAATCTGATAAATCAAGG + Intronic
1056596515 9:88012260-88012282 CTAGTGAAACTAATAAAACAAGG + Intergenic
1056894195 9:90526172-90526194 CTGTATAAACTAATAAAGAAAGG + Intergenic
1058079099 9:100682879-100682901 CTGGAATAACTGAATAAACATGG + Intergenic
1058678799 9:107423862-107423884 CTGGATAATATGACAAAACAGGG + Intergenic
1059474372 9:114532633-114532655 CTGGCTAAACTGAAAGAATAGGG + Intergenic
1060857210 9:126924428-126924450 CTGGCTATATTGATAAAACTAGG - Intronic
1061769279 9:132905611-132905633 CTGGACAGACTGATACAGCAGGG - Exonic
1185502864 X:611876-611898 CATGATAAGCAGATAAAACAAGG - Intergenic
1185783070 X:2865938-2865960 GTGAATAAACTGCAAAAACATGG - Intronic
1186134558 X:6505401-6505423 CTGAATACACATATAAAACATGG + Intergenic
1186318935 X:8403036-8403058 CTGGATAAACTGCTAAGACTTGG + Intergenic
1188886467 X:35556537-35556559 CTGGATAAACTGAATAAAAGAGG + Intergenic
1188992810 X:36844309-36844331 ATTGATAAACTCATAAATCAAGG - Intergenic
1189664147 X:43334717-43334739 CTGGATAAACTGTTTATAAAAGG + Intergenic
1190006018 X:46738852-46738874 CTGGCTAAACTCATCAAAAACGG + Intronic
1191599014 X:62982861-62982883 CTGGATAAACTGTAAAATTAAGG - Intergenic
1191957051 X:66654218-66654240 CTGGATAAACTTGAAAAAAATGG + Intergenic
1193160498 X:78223386-78223408 CTAGAGAAACTGAAACAACAAGG + Intergenic
1195386781 X:104321106-104321128 CTGGATAAATAGACAAAACATGG + Intergenic
1195640420 X:107168824-107168846 CTGGATAAATGCATAAACCATGG + Intronic
1196035836 X:111143783-111143805 CTGGAAAAATTAATAAAAAAGGG - Intronic
1196776067 X:119338989-119339011 CTGGAGAAACTCATAATTCATGG - Intergenic
1197427052 X:126310087-126310109 CTGGATAAACTACTGAATCATGG + Intergenic
1198126770 X:133652417-133652439 CTAGATCAACTTATTAAACAAGG + Intronic
1198197798 X:134382284-134382306 CTGTCTAAACTGCAAAAACAGGG - Intronic
1198636306 X:138704449-138704471 CTCAATAAACTTACAAAACAAGG - Intronic
1198994410 X:142557881-142557903 CAGGCTAACCTGATAAAACAAGG - Intergenic