ID: 1020725663

View in Genome Browser
Species Human (GRCh38)
Location 7:11810547-11810569
Sequence CAGTAACAGCAGCATTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020725663_1020725667 4 Left 1020725663 7:11810547-11810569 CCACCCCAATGCTGCTGTTACTG 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1020725667 7:11810574-11810596 ATTTGTAATAGATCAAAATGTGG No data
1020725663_1020725668 10 Left 1020725663 7:11810547-11810569 CCACCCCAATGCTGCTGTTACTG 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1020725668 7:11810580-11810602 AATAGATCAAAATGTGGAAATGG No data
1020725663_1020725669 11 Left 1020725663 7:11810547-11810569 CCACCCCAATGCTGCTGTTACTG 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1020725669 7:11810581-11810603 ATAGATCAAAATGTGGAAATGGG 0: 1
1: 0
2: 0
3: 36
4: 386
1020725663_1020725670 12 Left 1020725663 7:11810547-11810569 CCACCCCAATGCTGCTGTTACTG 0: 1
1: 0
2: 1
3: 19
4: 239
Right 1020725670 7:11810582-11810604 TAGATCAAAATGTGGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020725663 Original CRISPR CAGTAACAGCAGCATTGGGG TGG (reversed) Intronic
900208375 1:1441148-1441170 CAGGAACTGCAGCATTGAGGTGG + Exonic
900431580 1:2605448-2605470 CACTAACACCAGCTTCGGGGAGG + Intronic
901441822 1:9282694-9282716 CAGAAAGAGGAGCACTGGGGTGG - Intergenic
901470050 1:9449893-9449915 CAGTAACAGCCGCATGGTGGCGG + Intergenic
902178916 1:14672819-14672841 CAGTGACAGCAGCTTAGAGGTGG - Intronic
902511520 1:16969389-16969411 CAGTAAGAGCAGGCTTGGAGGGG + Intronic
905805730 1:40875904-40875926 CAGCAGCAGCAGCAATGTGGAGG - Intergenic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
908511757 1:64855061-64855083 CTGTAACATCAGCATTAGGCTGG + Intronic
908930840 1:69314881-69314903 CAGTAGTGGCAGCAGTGGGGTGG + Intergenic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
915032890 1:152899280-152899302 CAGTAACAGCTTTATTGGGGAGG + Intergenic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
919508029 1:198424692-198424714 AAGTGACAGCAGAGTTGGGGAGG + Intergenic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921471566 1:215556686-215556708 CAGAAATGGCAGCAGTGGGGTGG + Intergenic
923311146 1:232736818-232736840 CCCTAACAGCAGGATTGTGGAGG - Intergenic
923465117 1:234241477-234241499 CAGTAACCCCAGCACTTGGGAGG + Intronic
924586493 1:245365470-245365492 CAGGAAGATCAGCATTTGGGGGG - Intronic
1063492598 10:6478562-6478584 CAGAAAAAGCAGCCTTGGAGTGG - Intronic
1065467456 10:26040023-26040045 CAGTGACAGCAGTAATGGGAGGG - Intronic
1065867172 10:29924459-29924481 CAATAACTCCAGCATTGGGCAGG + Intergenic
1067320093 10:45210589-45210611 TAGTAACAGCAGCAATGTGTTGG + Intergenic
1067489164 10:46681575-46681597 CTGTTACAGCAGCCTTGGGAGGG + Intergenic
1067605508 10:47658798-47658820 CTGTTACAGCAGCCTTGGGAGGG - Intergenic
1069539244 10:69281276-69281298 CAGTAACAACAGCATTAGGTGGG - Intronic
1070580325 10:77714120-77714142 GACTAACAGCAGCGCTGGGGTGG - Intergenic
1070988289 10:80707620-80707642 CAGTATCTGCAGCTCTGGGGAGG + Intergenic
1071621065 10:87120193-87120215 CTGTTACAGCAGCCTTGGGAGGG - Intronic
1071793550 10:88981613-88981635 CAGTACCACAAGCAGTGGGGTGG + Intronic
1073064526 10:100750268-100750290 GAGAAGCAGCAGCATTTGGGAGG + Intronic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1074121207 10:110495799-110495821 CAGTGACAGCAGCTATGGGGAGG - Intergenic
1074524876 10:114254507-114254529 CAGTAACAGCAGCAATGTGGAGG - Intronic
1078148448 11:8738596-8738618 CAGTAGCAGCAGGGATGGGGAGG - Intronic
1080898300 11:36463872-36463894 TAGGAAAAGCTGCATTGGGGTGG + Exonic
1081180842 11:39984289-39984311 CAGTAAGTGCAGTATTAGGGTGG - Intergenic
1083169031 11:60911362-60911384 CAGCAACAGCAGCTTTGGTCTGG - Intergenic
1083700397 11:64473689-64473711 AGTTAACAGCAGAATTGGGGAGG + Intergenic
1086462818 11:87022465-87022487 CAACAACAGCAGCTTTGAGGTGG - Intergenic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1088154243 11:106784175-106784197 CAATAACAGCAGGAAAGGGGAGG - Intronic
1088707711 11:112478658-112478680 CATTACCACCAGCATTGAGGTGG - Intergenic
1091219318 11:133920793-133920815 CAGCAGCAGCAGCCCTGGGGAGG - Exonic
1091523879 12:1276494-1276516 CAGTAATCCCAGCATTTGGGAGG - Intronic
1091934486 12:4424185-4424207 TGGTGACTGCAGCATTGGGGAGG - Intergenic
1092826810 12:12407964-12407986 CTGTAACCCCAGCATTTGGGAGG - Intronic
1094783267 12:33817920-33817942 CAGCAACTGCAGCAGTGTGGTGG + Intergenic
1095879223 12:47114599-47114621 CAGTAGCAGAAGTAGTGGGGAGG - Intronic
1096111863 12:49033642-49033664 CAGCAACAGCAACATTCTGGTGG - Exonic
1096258005 12:50074439-50074461 CAGGAAAAGCAGCACTGGTGTGG - Intronic
1096628087 12:52907408-52907430 CTCTAACAGCAGCGTGGGGGAGG - Intronic
1097681248 12:62651442-62651464 TAGTAATAGCAGCATCAGGGTGG - Intronic
1099181020 12:79472846-79472868 TAGTAACAGCATCACGGGGGCGG - Intergenic
1101044829 12:100794426-100794448 CATTAACAGCAGCAGTGGAGAGG + Intronic
1101097494 12:101357851-101357873 CAGTATCAGCAGCATCTGAGGGG + Intronic
1102123108 12:110458522-110458544 CAGTAATCCCAGCATTTGGGAGG + Intronic
1102425804 12:112843564-112843586 CAGTAACACCGGCAATGGTGTGG + Intronic
1110308992 13:74024489-74024511 CAGTAACAGCAGCAATCAGCTGG + Intronic
1111123106 13:83879710-83879732 CAGTAAAAACAGCACTGGGTTGG - Exonic
1111709439 13:91793302-91793324 CAGTAACTGAATCATGGGGGCGG - Intronic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1114675639 14:24438522-24438544 CAGTAACAGCAGAGTTGGTCTGG - Exonic
1115507575 14:34107385-34107407 TAGTAACTACAGCAGTGGGGCGG - Intronic
1115888579 14:38001817-38001839 CAGCAACAGCAGCATTAGCTGGG - Intronic
1118015343 14:61655005-61655027 CAGAAAAAGCAGCATTTGGCCGG + Intronic
1119533018 14:75376380-75376402 CAGTACCAGTATCATGGGGGTGG - Intergenic
1120218415 14:81705225-81705247 CGGTAAAAGCAACATTTGGGTGG + Intergenic
1122607373 14:102956163-102956185 CAGGAACAGGAACATTGAGGAGG + Intronic
1122926394 14:104904932-104904954 CAGGACCACCAGGATTGGGGTGG - Intergenic
1123100395 14:105793788-105793810 CAGTAACAGTAGCAGTGTGACGG - Intergenic
1124338548 15:28875307-28875329 CAGTAACAGTCGGGTTGGGGGGG + Intergenic
1124685534 15:31778574-31778596 CAGCACCTGCAGCATTGGAGTGG - Intronic
1125882157 15:43204321-43204343 CAGCAGCAGCAGCATTTAGGGGG - Intronic
1126761644 15:51974972-51974994 CAGTAATCCCAGCATTTGGGAGG - Intronic
1126900343 15:53308321-53308343 AATTAACAGATGCATTGGGGTGG + Intergenic
1130192600 15:81750783-81750805 TGGTAACAGCAGCACTGCGGAGG - Intergenic
1131329128 15:91480107-91480129 CAGTAACTGGAGCAATGGGGAGG + Intergenic
1132026091 15:98405531-98405553 CAGCAACAGCAGCCTGGGGCAGG - Intergenic
1133167412 16:3957992-3958014 CAGAAACAGCAGCTCTCGGGAGG + Intronic
1134336151 16:13301398-13301420 CAGCAACAGCAGCATTATGTGGG - Intergenic
1134757166 16:16677850-16677872 CAGTAATATCAGCATTTGGAGGG + Intergenic
1134988902 16:18681313-18681335 CAGTAATATCAGCATTTGGAGGG - Intergenic
1136550465 16:30979923-30979945 CAGCAGCAGCAGCGATGGGGAGG + Exonic
1137835255 16:51585987-51586009 CTGTAATACCAGCATTTGGGAGG - Intergenic
1138571174 16:57874207-57874229 CACTAACAGCAGCCTGGGGTGGG + Intergenic
1139244820 16:65431436-65431458 CAGTGACAGCAGCTATGGTGGGG - Intergenic
1139656985 16:68394656-68394678 CAGTCACAGCTGCTTTGGGCAGG + Intronic
1141042846 16:80687165-80687187 CTGAAACAGCAGCATTTGTGAGG + Intronic
1141989611 16:87602570-87602592 CAGCAGCAGCAGCAATGCGGCGG - Intronic
1144809946 17:17992640-17992662 CAGCACCATCAGCACTGGGGTGG - Intronic
1147891067 17:43717278-43717300 CAGAAACAGCAAAATTGGGTGGG - Intergenic
1148438238 17:47698424-47698446 CCGCAACAGCTGCATTGCGGTGG + Intronic
1151967524 17:77439238-77439260 GAGCAACAGCAGCATTGGCAGGG + Intronic
1152403581 17:80083638-80083660 CAGTCACAGCTGCAATGGTGTGG - Intronic
1152504175 17:80736406-80736428 AAGTCACTGCAGCCTTGGGGAGG - Intronic
1152798948 17:82322239-82322261 CAGTGCCAGCGGCCTTGGGGTGG + Exonic
1152870125 17:82749405-82749427 CTGTAATCGCAGCATTTGGGAGG + Intronic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1155197417 18:23488144-23488166 CAGTAACCCCAGCAGTGGGCAGG + Intergenic
1156272843 18:35552825-35552847 CAGTAACTGGACCTTTGGGGAGG - Intergenic
1156456755 18:37299158-37299180 CAGTCACCGCACCATGGGGGAGG + Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1162187265 19:8915346-8915368 CTGTAATACCAGCATTTGGGAGG - Intronic
1163256714 19:16160500-16160522 CTGTAACCCCAGCATTTGGGAGG - Intergenic
1164719759 19:30423778-30423800 CAGTGACAGCAGCTGTGGCGGGG + Intronic
1165779470 19:38423895-38423917 CAGGAACAGCAGCCTCTGGGAGG - Intronic
1167108315 19:47444149-47444171 CTGTAACCCCAGCACTGGGGAGG - Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
926050778 2:9743259-9743281 CTGTAATTGCAGCATTTGGGAGG - Intergenic
929196204 2:39187421-39187443 GAGTAATTCCAGCATTGGGGAGG + Intronic
931275425 2:60739964-60739986 CTGTAATACCAGCATTTGGGAGG - Intergenic
931366416 2:61623056-61623078 CTGTAATATCAGCATTTGGGAGG + Intergenic
932429921 2:71668012-71668034 CAGAGACAGCAGCCTTGGGATGG + Intronic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
935406900 2:102718848-102718870 CAGTTACAGCAGCATGCTGGGGG - Exonic
935575118 2:104701306-104701328 CAGTTTCAGCAGCAATGTGGAGG - Intergenic
936614987 2:114039469-114039491 CACTTACAGCAGCAGTTGGGAGG - Intergenic
936765514 2:115843492-115843514 CAGTAACAGATGAATTGGGCAGG - Intronic
939753472 2:146078258-146078280 CAGTAGCAGCTACATTTGGGTGG - Intergenic
940460074 2:153953829-153953851 AATTCAGAGCAGCATTGGGGAGG - Intronic
940684397 2:156827774-156827796 CAGCAATAGCAGCAATGGGCTGG - Intergenic
941174816 2:162183787-162183809 AAGTAGCAGCAGCATTGAGCAGG + Intronic
947514941 2:230795017-230795039 CTGTAATACCAGCATTTGGGAGG + Intronic
1169504402 20:6193128-6193150 CAGAAACTGGAGAATTGGGGAGG + Intergenic
1170041948 20:12048450-12048472 CAGTTACAGCAGCCTGGGGAGGG + Intergenic
1170814587 20:19702590-19702612 CAGAAACAGCAGCATTTGGATGG - Intronic
1172017877 20:31889675-31889697 CTGTAACCCCAGCATTTGGGAGG - Intronic
1172087398 20:32397651-32397673 CAATTCCAGCAGCATTTGGGAGG - Intronic
1173132500 20:40408049-40408071 CAGTGACAGCACAATTTGGGAGG - Intergenic
1175693915 20:61086949-61086971 AAGTAACAGAATCATGGGGGTGG - Intergenic
1177918070 21:27115607-27115629 CAGTAACAGCAGGACTCTGGGGG + Intergenic
1179069322 21:38056873-38056895 CAATAACAGCAGCTTTGGTTTGG - Intronic
1181829059 22:25544754-25544776 CAGTAACAACAGCAGCGTGGTGG - Intergenic
1182534094 22:30987147-30987169 CAGAAACAGCAGAATTAGGCCGG - Intergenic
1183009258 22:34931551-34931573 GAGAACCAGCAGCACTGGGGTGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1185175427 22:49323856-49323878 CACTCACAGCTGCACTGGGGAGG - Intergenic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
950080134 3:10216075-10216097 CATTTACAGCAGTCTTGGGGAGG + Intronic
950521350 3:13499812-13499834 CAGTAACACCTGCCATGGGGAGG - Intronic
950940078 3:16884017-16884039 CAGTTGCAGCAGCTCTGGGGAGG + Intronic
951955924 3:28253318-28253340 CTGTAATCCCAGCATTGGGGAGG + Intronic
952591460 3:34959974-34959996 GAGTAACAGCAGCTTGGAGGTGG + Intergenic
954202820 3:49034644-49034666 CAGTAACACCAGCCCTGTGGGGG - Intronic
955618449 3:60834599-60834621 CTGTAATACCAGCATTTGGGAGG + Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
956982132 3:74651258-74651280 CAATAAAAGCAGCATCGGGCCGG - Intergenic
959977079 3:112472892-112472914 CAGAAACAGCTGCCTGGGGGAGG + Intronic
962270776 3:133976598-133976620 CCGGAACAGCTGCATTTGGGGGG - Intronic
964191320 3:154004334-154004356 CAGTCATAGCAGCAGTGGAGAGG + Intergenic
964504880 3:157388368-157388390 CAGCCAAAGAAGCATTGGGGTGG - Intronic
968254223 3:197251126-197251148 CTGTAACCCCAGCATTTGGGAGG + Intronic
968961925 4:3750028-3750050 CAGTACCAGCGGCTTGGGGGTGG + Intergenic
969661569 4:8532656-8532678 CAGGAACATCAGCACTGGGGTGG + Intergenic
970281564 4:14461971-14461993 CAGAAACAGCCACATTGAGGAGG + Intergenic
972697279 4:41459826-41459848 CAGTAAGAGCTGCAATGTGGAGG + Intronic
973713800 4:53655244-53655266 CAGTATCTGAAGCCTTGGGGTGG - Intronic
974019021 4:56676727-56676749 TTGTGACAGCAGCAGTGGGGAGG - Intronic
974205149 4:58692614-58692636 TAGTAAAAGCAGTATTAGGGGGG - Intergenic
974479877 4:62429519-62429541 CAATAACAGCAGCATTAGTAGGG + Intergenic
976726028 4:88216535-88216557 TAGTTACAGCAGCCTTGGTGAGG - Intronic
976761407 4:88553225-88553247 CACTAACAGCAGAGTTTGGGAGG + Intronic
977194157 4:94038653-94038675 CAGTTGGAGCAGCATTGGGGAGG - Intergenic
977719624 4:100224194-100224216 CTGTAACAGCAGCTTTAGGCAGG + Intergenic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
978733417 4:112057789-112057811 CAGTCACAGCACCAATGAGGTGG - Intergenic
981670366 4:147279598-147279620 CAGCAACAGCAGCTTTGGCAGGG - Intergenic
981782341 4:148443551-148443573 TAGTAACTGCAGCATTTGGGTGG - Intronic
982949912 4:161680812-161680834 CAATAACAGTAGCATTATGGAGG + Intronic
983709890 4:170700929-170700951 CAGGAACAGCTACATTGGGCAGG + Intergenic
984404085 4:179304372-179304394 CTGTAACCTCAGCATTTGGGAGG - Intergenic
984529895 4:180902824-180902846 CACTAAAAGAGGCATTGGGGTGG - Intergenic
985482474 5:124003-124025 CAGCAAAAGCAGCATTAAGGGGG - Intergenic
988635036 5:32974012-32974034 CAGTAACAGGAGCAGTGGTTTGG - Intergenic
989985278 5:50689887-50689909 CAGTCCCAGCAGCCTTGGGCTGG - Intronic
990577255 5:57135392-57135414 CAGTAACAGCAGTTTTAGGCTGG - Intergenic
992614513 5:78535629-78535651 CTGCAGCATCAGCATTGGGGTGG - Intronic
992778856 5:80110321-80110343 CAGTAACAGCAGCATTGCCAGGG - Intergenic
993498422 5:88634982-88635004 CACAAACAGAAGCATTGGGATGG + Intergenic
995560322 5:113374147-113374169 CTGTAACCGCAGCCTTTGGGAGG - Intronic
996162566 5:120183449-120183471 CAGTAAAAGCAGTATTCAGGGGG + Intergenic
998126376 5:139625370-139625392 CTGTAACAGCAGCACTTTGGGGG - Intronic
998510493 5:142709855-142709877 CAGAAGCAGCAGCATTTGAGAGG + Intergenic
998851762 5:146357762-146357784 CTGTAATACCAGCATTTGGGAGG - Intergenic
1001108566 5:168876307-168876329 CAGCTTCAGCAGCAGTGGGGAGG - Intronic
1001705866 5:173740877-173740899 CAGGAAGAGCAGGCTTGGGGAGG - Intergenic
1002894156 6:1366040-1366062 CAGAAATAGCAGCATTGTGTCGG + Intergenic
1003035381 6:2636902-2636924 CAGAAACAACAACGTTGGGGAGG - Intergenic
1005601201 6:27428030-27428052 CAGTGACAGGAGCAAAGGGGAGG - Intergenic
1006187866 6:32190809-32190831 CAGACTCAGCAGCAGTGGGGAGG + Exonic
1006371097 6:33643933-33643955 CTGTAACTGCAGCACTTGGGAGG + Intronic
1006525086 6:34597386-34597408 CAGTAACAGTCTCACTGGGGAGG + Intronic
1007341845 6:41195606-41195628 CAGAACAAGCAGCATTGGTGAGG + Intronic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009919734 6:70042725-70042747 AAGTAACAGCAGCATTTGAGAGG - Intronic
1010052608 6:71525409-71525431 CACTAACAGCAACATAGGCGTGG + Intergenic
1014509411 6:122302631-122302653 CTGTAAAATCAGCATTGGGCTGG - Intergenic
1014558231 6:122859193-122859215 CAGTGTCAGCAGCAAGGGGGAGG - Intergenic
1015974989 6:138781018-138781040 AAGTAACAAAAACATTGGGGAGG - Intronic
1016905965 6:149151198-149151220 CACTGAAAGCAGCAGTGGGGAGG + Intergenic
1018919458 6:168161276-168161298 CAGTAACGGCAGCATGGCCGAGG + Intergenic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1024770992 7:52723296-52723318 CAGTAACATCAGTATAGGTGAGG - Intergenic
1030941138 7:115651056-115651078 CTGTTACAGCTGCATTGGGCTGG + Intergenic
1032865934 7:135924452-135924474 TGGAAACAGCAGCCTTGGGGTGG - Intergenic
1034026307 7:147708232-147708254 CAGTGACAGCAGCTGTGGGCAGG + Intronic
1034516161 7:151581881-151581903 CAGTATCTGCAGCATTTTGGGGG - Intronic
1037368274 8:18145818-18145840 CTGTAATTCCAGCATTGGGGAGG - Intergenic
1038669393 8:29570361-29570383 GAGTCACAGAAGCAATGGGGGGG - Intergenic
1039425205 8:37479658-37479680 CAGGGACAGCAGCACTGGGCGGG + Intergenic
1039989189 8:42473585-42473607 CAGGAACAGTGGCATGGGGGAGG - Intronic
1040662680 8:49594348-49594370 CAGAAAGAGCAGAATTGGGTGGG + Intergenic
1040676368 8:49756034-49756056 CAGTAACAACAGCAGGGAGGAGG - Intergenic
1040746044 8:50643751-50643773 CAGTAACAGCAGGGCTGGGGAGG + Intronic
1041719132 8:60960585-60960607 GAGTCACAGCAGCAGTGGAGAGG - Intergenic
1044336315 8:90987892-90987914 CAGTAATGCCAGCAATGGGGAGG + Intergenic
1045172077 8:99682652-99682674 AGGTAACATCAGCATTGTGGTGG + Intronic
1045181758 8:99791861-99791883 CAGTCACGGCAGCACAGGGGTGG + Intronic
1045705479 8:104917522-104917544 CAGCAACAGCACAAGTGGGGAGG + Intronic
1045832424 8:106479535-106479557 CAGTACCAGGGGGATTGGGGTGG - Intronic
1046121147 8:109848662-109848684 CAGTAGCAGCAGCCCTGGGCAGG + Intergenic
1047215244 8:122870797-122870819 CAGTCACAGCAGAAATGGAGTGG + Intronic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1050763003 9:9096913-9096935 CAGTGACTTCAGCATTTGGGAGG - Intronic
1051003970 9:12319438-12319460 CTGTAGCAGCAGCTTTGAGGTGG + Intergenic
1051372862 9:16373117-16373139 CTGTAACAGCTGGATGGGGGTGG + Intergenic
1053326293 9:37154749-37154771 CTGTAATCCCAGCATTGGGGAGG - Intronic
1053478448 9:38398766-38398788 CAAAAACAGAAACATTGGGGAGG - Intergenic
1056930635 9:90873666-90873688 GAGATGCAGCAGCATTGGGGTGG - Intronic
1057108501 9:92444737-92444759 CAGGCAAAGCAGCATGGGGGAGG + Intronic
1057516018 9:95721884-95721906 CAGCAACAGTTGCTTTGGGGAGG - Intergenic
1058103968 9:100949302-100949324 CACTAACTGCATCATTGAGGGGG + Intergenic
1058923269 9:109638608-109638630 CAGTGGCAGCGGCATGGGGGAGG + Intergenic
1059646759 9:116275782-116275804 TAGTAACACCAGCGTTAGGGTGG + Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1061158748 9:128881375-128881397 CAGTAAAAACAGCGTTGGGCCGG - Intronic
1061486307 9:130922231-130922253 CAGTGGCAGCAGCCCTGGGGCGG + Intronic
1061606693 9:131716245-131716267 CAGAAACTGTATCATTGGGGGGG - Intronic
1185777804 X:2819559-2819581 CAGTAACTGCAGAATTTGAGAGG + Intergenic
1185922507 X:4109244-4109266 CAGATTCAGCAGCATTGGAGTGG - Intergenic
1186165725 X:6824142-6824164 CAAGAACAGCAGCATAGGGGTGG - Intergenic
1187636669 X:21237367-21237389 CAGTAACAGCTGCATGGCGCAGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1191688628 X:63917906-63917928 CAGAACCAACAGGATTGGGGTGG + Intergenic
1191995384 X:67089535-67089557 CAGTAGCAGCAGCCTTGGGCAGG + Intergenic
1192014839 X:67317896-67317918 CAGATAGAGCAGCATTGAGGAGG - Intergenic
1192423942 X:71059448-71059470 CAGCAACAACAACATTGGCGAGG + Exonic
1192845432 X:74902488-74902510 AGGTAACAGAAGGATTGGGGAGG + Intronic
1195289099 X:103414370-103414392 CAGGCAAAGCTGCATTGGGGAGG + Intergenic
1197542721 X:127786036-127786058 CAGTAAAAGCAGTATTTAGGGGG - Intergenic
1198303730 X:135358503-135358525 CAATAACAGCAGAAATGAGGTGG - Intronic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1201327479 Y:12779141-12779163 CAGTCACTTCAGCATTAGGGAGG + Intronic
1202103048 Y:21330370-21330392 CTGTGGCAGCAGCATTGGGCAGG - Intergenic