ID: 1020729232

View in Genome Browser
Species Human (GRCh38)
Location 7:11860151-11860173
Sequence GCATCTATTATATTTATATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020729232_1020729234 30 Left 1020729232 7:11860151-11860173 CCGTATATAAATATAATAGATGC No data
Right 1020729234 7:11860204-11860226 CATTTTTTTAAAATACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020729232 Original CRISPR GCATCTATTATATTTATATA CGG (reversed) Intergenic
No off target data available for this crispr