ID: 1020736834

View in Genome Browser
Species Human (GRCh38)
Location 7:11960780-11960802
Sequence CCATATAATCCCCTTTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020736831_1020736834 17 Left 1020736831 7:11960740-11960762 CCTGATTATTTGCATTAAGTGCA No data
Right 1020736834 7:11960780-11960802 CCATATAATCCCCTTTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020736834 Original CRISPR CCATATAATCCCCTTTAAAT TGG Intergenic
No off target data available for this crispr