ID: 1020737594

View in Genome Browser
Species Human (GRCh38)
Location 7:11970585-11970607
Sequence CCTGCTTTTCATCCTGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020737594_1020737598 -10 Left 1020737594 7:11970585-11970607 CCATACACAGGATGAAAAGCAGG No data
Right 1020737598 7:11970598-11970620 GAAAAGCAGGCAAGGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020737594 Original CRISPR CCTGCTTTTCATCCTGTGTA TGG (reversed) Intergenic
No off target data available for this crispr