ID: 1020740067

View in Genome Browser
Species Human (GRCh38)
Location 7:12004748-12004770
Sequence CTTCCTCCCTAGAAGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020740067_1020740071 -4 Left 1020740067 7:12004748-12004770 CCCTTTTTCTTCTAGGGAGGAAG No data
Right 1020740071 7:12004767-12004789 GAAGGTACCTGCAGCGAGCAGGG No data
1020740067_1020740074 30 Left 1020740067 7:12004748-12004770 CCCTTTTTCTTCTAGGGAGGAAG No data
Right 1020740074 7:12004801-12004823 TCCAGGCAATAACATTAATCTGG No data
1020740067_1020740073 13 Left 1020740067 7:12004748-12004770 CCCTTTTTCTTCTAGGGAGGAAG No data
Right 1020740073 7:12004784-12004806 GCAGGGAAGTCTGCTTCTCCAGG No data
1020740067_1020740070 -5 Left 1020740067 7:12004748-12004770 CCCTTTTTCTTCTAGGGAGGAAG No data
Right 1020740070 7:12004766-12004788 GGAAGGTACCTGCAGCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020740067 Original CRISPR CTTCCTCCCTAGAAGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr