ID: 1020740070

View in Genome Browser
Species Human (GRCh38)
Location 7:12004766-12004788
Sequence GGAAGGTACCTGCAGCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020740067_1020740070 -5 Left 1020740067 7:12004748-12004770 CCCTTTTTCTTCTAGGGAGGAAG No data
Right 1020740070 7:12004766-12004788 GGAAGGTACCTGCAGCGAGCAGG No data
1020740068_1020740070 -6 Left 1020740068 7:12004749-12004771 CCTTTTTCTTCTAGGGAGGAAGG No data
Right 1020740070 7:12004766-12004788 GGAAGGTACCTGCAGCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020740070 Original CRISPR GGAAGGTACCTGCAGCGAGC AGG Intergenic
No off target data available for this crispr