ID: 1020744877

View in Genome Browser
Species Human (GRCh38)
Location 7:12068399-12068421
Sequence CTTTAGTTGTAGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020744877_1020744889 23 Left 1020744877 7:12068399-12068421 CCCTTTTCCCTCTACAACTAAAG No data
Right 1020744889 7:12068445-12068467 TTAAGATAGGTGCCACAAGGAGG No data
1020744877_1020744890 26 Left 1020744877 7:12068399-12068421 CCCTTTTCCCTCTACAACTAAAG No data
Right 1020744890 7:12068448-12068470 AGATAGGTGCCACAAGGAGGAGG No data
1020744877_1020744884 10 Left 1020744877 7:12068399-12068421 CCCTTTTCCCTCTACAACTAAAG No data
Right 1020744884 7:12068432-12068454 TGATCTCCTTCCCTTAAGATAGG No data
1020744877_1020744887 20 Left 1020744877 7:12068399-12068421 CCCTTTTCCCTCTACAACTAAAG No data
Right 1020744887 7:12068442-12068464 CCCTTAAGATAGGTGCCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020744877 Original CRISPR CTTTAGTTGTAGAGGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr