ID: 1020746265

View in Genome Browser
Species Human (GRCh38)
Location 7:12082079-12082101
Sequence ATATAGGAGGGATGGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746265_1020746281 20 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746265_1020746282 23 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746282 7:12082125-12082147 GGATGGTTGTGGTTTGGAGGTGG No data
1020746265_1020746278 6 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746278 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data
1020746265_1020746280 17 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746265_1020746274 2 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data
1020746265_1020746273 -2 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746273 7:12082100-12082122 ATATGGCCCCTTAACACTAATGG No data
1020746265_1020746279 12 Left 1020746265 7:12082079-12082101 CCCACCTACCATCCCTCCTATAT No data
Right 1020746279 7:12082114-12082136 CACTAATGGATGGATGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746265 Original CRISPR ATATAGGAGGGATGGTAGGT GGG (reversed) Intergenic
No off target data available for this crispr