ID: 1020746270

View in Genome Browser
Species Human (GRCh38)
Location 7:12082091-12082113
Sequence TTAAGGGGCCATATATAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020746270_1020746279 0 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746279 7:12082114-12082136 CACTAATGGATGGATGGTTGTGG No data
1020746270_1020746281 8 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746281 7:12082122-12082144 GATGGATGGTTGTGGTTTGGAGG No data
1020746270_1020746280 5 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746280 7:12082119-12082141 ATGGATGGATGGTTGTGGTTTGG No data
1020746270_1020746282 11 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746282 7:12082125-12082147 GGATGGTTGTGGTTTGGAGGTGG No data
1020746270_1020746274 -10 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746274 7:12082104-12082126 GGCCCCTTAACACTAATGGATGG No data
1020746270_1020746283 19 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746283 7:12082133-12082155 GTGGTTTGGAGGTGGTAACGAGG No data
1020746270_1020746278 -6 Left 1020746270 7:12082091-12082113 CCCTCCTATATATGGCCCCTTAA No data
Right 1020746278 7:12082108-12082130 CCTTAACACTAATGGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020746270 Original CRISPR TTAAGGGGCCATATATAGGA GGG (reversed) Intergenic